Question

Recall that DNA is a template for mRNA. Every three mRNA nucleotides make up a codon...

Recall that DNA is a template for mRNA. Every three mRNA nucleotides make up a codon which corresponds to a specific amino acid. The properties of the amino acids determine how the protein folds. Explain how the differences in each of the DNA sequences used still allow each organism to make the same functional protein. (Note: A chart showing amino acids and the corresponding DNA genetic code may be useful. You can search for this online using the term “DNA codon chart.” Remember that DNA uses Thymine instead the Uracil used in mRNA.)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Transcription is a process in which synthesis of mRNA from DNA.

Transcription - one strand of DNA serves as a template and synthesis working copies of mRNA, other strand does not participate in the process is known as coding strand.

For instance :-

DNA - 5' A T G C A T G G C A 3' Coding strand.

3' T A C G T A C C G T 5' Template strand

mRNA :- 5' A U G C A U G G C A 3'

Translation is the process of synthesis of protein from mRNA.

The sequence of amino acids in the protein synthesized is determined by the nucleotide bases sequence of mRNA.

Genetic code : the three nucleotide base sequence in mRNA that acts as code words for amino acids in protein are known as codon.

61 condoms codes for 20 amino acids.

Codons - AUG, GUG are initiating codons where as UAA, UAG, UGA are stop codons which terminates the process of translation.

Codons are recognized by the anticodons pf tRNA .

For instance mRNA 5' A U G C A U G G C A 3' codes for:-

Amino acid sequence : methionine(AUG) , histidine(CAU) , glycine(GGC) .  

Change in sequence of mRNA will alters the sequence of amino acid and the changes in the mRNA are the result of change in the nucleotides sequence in the DNA .

For instance : addition of 'G' base in the above mRNA :-

5' AUG G C A U G G C A 3'

Amino acids - Methionine(AUG) , alanine(GCA) , Tryptophan (UGG) .

If you find my answer useful please give me a thumbs up. Thank you

Add a comment
Know the answer?
Add Answer to:
Recall that DNA is a template for mRNA. Every three mRNA nucleotides make up a codon...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • 1. Proteins consist of: genes. chains of amino acids. RNA plus mRNA. chains of DNA nucleotides....

    1. Proteins consist of: genes. chains of amino acids. RNA plus mRNA. chains of DNA nucleotides. 2. The structure of DNA is a triple helix double helix hoogesteen comlex 3. There are ______ amino acids that humans use. 15 10 20 25 4. RNA differs from DNA in that it uses: Group of answer choices uracil instead of thymine. uracil instead of guanine. guanine instead of uracil. uracil instead of adenine.

  • 3. Below is the template DNA sequence for a short human protein: Template DNA = 3’...

    3. Below is the template DNA sequence for a short human protein: Template DNA = 3’ GCATGACTATTAATACGTGCGCTACCAGACTTGA5’ A. How many amino acids will the protein translated from this mRNA have? B. How many nucleotides in total will be transcribed but not translated? Assume that the stop codon is not part of the untranslated region.

  • What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...

    What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...

  • In protein biosynthesis Question options: A. each amino acid recognizes its codon on the mRNA template...

    In protein biosynthesis Question options: A. each amino acid recognizes its codon on the mRNA template because of structural specificity. B. exactness of read-out is assured by the presence of traces of DNA on the ribosome. C. each amino acid is first attached to tRNA that has an anticodon specific for the amino acid. D. a given codon-anticodon pair must have identical base sequences to avoid the formation of degenerate proteins. E. each amino acid recognizes its codon through recognition...

  • c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...

    c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...

    Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...

  • 1. Transcription occurs in the a. Nucleus. b. Ribosomes of the Rough Endoplasmic Reticulum. c. Mitochondrion....

    1. Transcription occurs in the a. Nucleus. b. Ribosomes of the Rough Endoplasmic Reticulum. c. Mitochondrion. d. Cell membrane. e. Smooth Endoplasmic Reticulum. 2. The monomers of DNA and RNA are a. amino acids. b. monosaccharides. c. nucleotides. d. fatty acids. e. nucleic acids. 3. Which of the following statements regarding DNA is false? a. DNA uses the nitrogenous base uracil. b. DNA is a nucleic acid. c. One DNA molecule can include four different nucleotides in its structure. d....

  • The sequence below represents the first section of the template strand of DNA of a structural...

    The sequence below represents the first section of the template strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written 3 GTAACTĀTAATTACGCGTATAATGAT 5 What would be the nucleotides that form the promoter? What would be the 5'UTR sequence? What would be the sequence...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT