In protein biosynthesis
Question options:
|
A. each amino acid recognizes its codon on the mRNA template because of structural specificity. |
||
|
B. exactness of read-out is assured by the presence of traces of DNA on the ribosome. |
||
|
C. each amino acid is first attached to tRNA that has an anticodon specific for the amino acid. |
||
|
D. a given codon-anticodon pair must have identical base sequences to avoid the formation of degenerate proteins. |
||
|
E. each amino acid recognizes its codon through recognition nucleotides in its specific transfer RNA molecule. |
||

In protein biosynthesis Question options: A. each amino acid recognizes its codon on the mRNA template...
Label the diagram. Use these choices: transfer RNA (TRNA), amino acid, amino acid chain, codon, anticodon, messenger RNA (MRNA), ribosome ©--[oop (2) GU View as Text >>
During elongation of proteins during protein synthesis tRNA with the amino acid that matches its anticodon binds to the codon on the mRNA. each new amino acid is first transferred to the anticodon of the tRNA. anticodons on the ribosomes recognize the codons on the mRNA and attach the correct amino acids. ribosomes move along the DNA. RNA polymerase II uses the codons on the mRNA to polymerize the protein.
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
3. What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...
Recall that DNA is a template for mRNA. Every three mRNA nucleotides make up a codon which corresponds to a specific amino acid. The properties of the amino acids determine how the protein folds. Explain how the differences in each of the DNA sequences used still allow each organism to make the same functional protein. (Note: A chart showing amino acids and the corresponding DNA genetic code may be useful. You can search for this online using the term “DNA...
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth
Associated Amino Acid: Compare your mRNA codon and tRNA anticodon with the amino acid chart provided. Determine which amino acid is coded for and write its name next to the corresponding number below. ① START - methionine ⑤Click or tap here to enter text. ②Click or tap here to enter text. ⑥Click or tap here to enter text. ③Click or tap here to enter text. ⑦Click or tap here to enter text. ④Click or tap here to enter text. ⑧Click...
There are 20 different tRNA molecules, one for each of the 20 amino acids found in protein. During protein synthesis, the job of a tRNA molecule is to carry its particular amino acid to the growing protein chain and find the correct amino acid position there. It does this by matching a 3- letter anticodon on the tRNA to a complementary 3-letter codon on mRNA. Below, in a diagram of a ERNA molecule, nucleotides are represented by small circles, some...