Question

Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of DNA, mRNA, TRNA and/or polypeptide (AA : amino acids). Remember A codon chart can only be used for decoding a strand of mRNA Codon Chart a THrd DNA: TAC GCG CCT AGG 6GG TGG mRNA: DNA: TTC GAT TAG ATG CCG AAG mRNA: tRNA: - - DNA: mRNA:
0 0
Add a comment Improve this question Transcribed image text
Answer #1

I believe the correct answer to be as follows:

onple 1Ac 4cG.. CCT AGG.-444--T4G, Methionine- u2 ツー7.katinee Ba line _ Tyvesine-laau-Gigu LL

Feel free to leave a comment down below for any further query. good rating would be appretiated if you find my answer helpful. thank you.

Add a comment
Know the answer?
Add Answer to:
Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence fil...

    Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence file (alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence), and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or...

  • Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA:...

    Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA: GCG GCG TAC CCC AAA ATA GGG GCG CTC GCG ATT AAA CCG TTC CCC What is the untranscribed strand? What is the mRNA sequence that would be transcribed from the transcribed strand? What is the sequence of tRNA nucleotides that would match up with the mRNA? What is the amino acid sequence that would result from translation of the mRNA?

  • Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation...

    Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation and splicing systems, as well as by reverse transcriptase. Cephalopods like squid and octopus use this form of editing very extensively in their protein-coding regions.  For each of the following, please indicate how these enzymes can alter the mRNA to produce the indicated codon changes.   I (Ileu)  is changed to V (val): K (Lys) is changed to E (Glu): T (Thr) is changed to A (ala):...

  • Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...

    Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...

  • 1. Using the following DNA segment, the RNA transcribed and the translation DNA 5’ ATG CCG...

    1. Using the following DNA segment, the RNA transcribed and the translation DNA 5’ ATG CCG GGT ACA TTC GGC CCA TAC 3’ DNA 3’ TAC GGC CCA TGT AAG CCG GGT ATG 5’ RNA 5’ AUG CCG GGU ACA UUC GGC CCA UAC 3’ Protein met pro gly thr phe gly pro. tyr DRAW an example of each of the following (circle the mutation that has occurred): A silent mutation A frameshift mutation A nonsense mutation A missense mutation

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

    mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...

  • Examine the following nucleotide sequence from the sense strand of DNA. What is the amino acid...

    Examine the following nucleotide sequence from the sense strand of DNA. What is the amino acid sequence of the encoded protein? (Show work) ATG - CCT - TAC - GCC - CCT - GGA - GAC - GAA - AAG - AAG - GGT

  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

  • Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...

    Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT