HomeworkLib
Question

If the template strand for replication (the DNA strand that the DNA polymerase binds to and...

If the template strand for replication (the DNA strand that the DNA polymerase binds to and "reads") has the sequence 5'-AGGCTTCGCTCCCG-3' then the complementary strand synthesized by the DNA polymerase would be what ?

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

DNA is a double-stranded structure and the two strands are complementary to each other means A base pairs with T and C base pairs with G if G is present in one strand C is present in the corresponding location in the opposite strand similarly for A and T so the complementary strand is 3`-TCCGAAGCGAGGGC-5` ( two strands of DNA are antiparallel to each other)

0 0
Add a comment
Know the answer?
Add Answer to:
If the template strand for replication (the DNA strand that the DNA polymerase binds to and...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • 1) The DNA template is read in the ______ direction, and the new strand is synthesized...

    1) The DNA template is read in the ______ direction, and the new strand is synthesized in the ____ direction. A) 5' to 3' ; 3' to 5' B) 5' to 3' ; 5' to 3' C) 3' to 5' ; 5' to 3' D) 3' to 5' ; 3' to 5' 2) If a sequence of DNA is 5' AATTGCCGT 3', the complementary strand would be A) 3' AAAACGCCA 5' B) 3' TTAACGGCT 5' C) 5' ACGGCAATT 3' D)...

  • If DNA polymerase adds a G across from an 'A' in the template strand during DNA replication

    If DNA polymerase adds a G across from an 'A' in the template strand during DNA replication (and it is not repaired/replaced), what kind of mutation results after the next round of replication? Briefly explain

  • Which of the following statements about DNA replication is FALSE? Primase synthesizes the primers. DNA polymerase...

    Which of the following statements about DNA replication is FALSE? Primase synthesizes the primers. DNA polymerase is required to add new nucleotides to the growing ends of the DNA strands. DNA ligase joins the small DNA fragments of the lagging strand. Only one strand of the parent DNA serves as a template for a newly synthesized complementary strand.

  • If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...

    If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...

  • Note that one of the two halves of the DNA molecule is labeled template strand and...

    Note that one of the two halves of the DNA molecule is labeled template strand and the other is the non-template strand. In protein synthesis, the RNA polymerase reads the template strand and uses it to make mRNA, filling in complementary bases. The mRNA then closely resembles the non-template strand. a. In what two significant ways do the non-template strand and the mRNA differ?

  • Vocabulary: DNA Replication

    Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB) D. Topoisomerase E. Origin of Replication F. DNA Polymerase G. Leading Strand H. Lagging strand I. DNA Ligase J. Okazaki Fragment K. Replication Fork L. RNA Primer M. Topoisomerase .1. Site where the replication of a DNA molecule begins. 2. The new continuous complementary DNA strand synthesized in the direction for the replication fork. 3. A discontinuously synthesized DNA strand that elongates in a direction away from the replication fork 4. Relaxes...

  • 1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings...

    1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...

  • What is the primer in DNA replication? The first segment of template DNA that binds to...

    What is the primer in DNA replication? The first segment of template DNA that binds to primase. The primer is the dNTP that starts the reaction dNTP + DNAn → DNAn+1 + pyrophosphate. A short segment of RNA to which the growing DNA chain is bonded. A short sequence of DNA to which the growing DNA chain is bonded.

  • RNA polymerase binds to DNA after the double strands have been unwound by helicase. binds to...

    RNA polymerase binds to DNA after the double strands have been unwound by helicase. binds to the promoter region and synthesizes mRNA in a 3' to 5' direction. binds to the template strand in the promoter region. transcribes the poly A tail.

  • In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers...

    In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5’ ACTGA 3’) are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit) DNA Sequence 3’ TGACTCTAGCCTAGGACTATATCG 5’

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT