In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5’ ACTGA 3’) are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit)
DNA Sequence 3’ TGACTCTAGCCTAGGACTATATCG 5’
Dideoxynucleotides are inhibitors of DNA polymerase used in Sanger chain method of dna sequencing.
ddGTP will sequence the DNA strand at following positions:-
1. ACTG
2. ACTGAG
3.ACTGAGATCG
4.ACTGAGATCGG
5.ACTGAGATCGGATCCTG
6.ACTGAGATCGGATCCTGATATAG
7.ACTGAGATCGGATCCTGATATAGC
At the end of sequencing we will have total 7 fragments of DNA.
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers...
9. In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5' ACTGA 3') are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit)- 2.5pts DNA Sequence 3'TGACTCTAGCCTAGGACTATATCG 5'
1) You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
If the template strand for replication (the DNA strand that the DNA polymerase binds to and "reads") has the sequence 5'-AGGCTTCGCTCCCG-3' then the complementary strand synthesized by the DNA polymerase would be what ?
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
Fall 2017 CHE 380: Introduction to Biotechnology Exam3 (I hr 20 min) Question 3 (28 polnts) and label the reaction was conducted on the b. Read the sequence A DNA sequencing was template strand in a thin capillary gel tube containing primers, DNA polymerase, deox yribuneeleotides and|メイenmcaT luorescently tagged dideoxyribunecleotides and a e. The smallest fragment is computer was used to record the fluorescent peaks during fluorescently tagged with (A)ddATP (B) ddGTP (C) ddCTP (D) ddTTP was used to reoribunecleotidesnanTCAATGaTa...
3. Now, you repeat the procedure of question 2, but you add a complete dNTP mix (containing ATP, CTP, dGTP, and dTTP), and ddGTP. In this way, when the DNA polymerase incorporates a nucleotide carrying guanine into the growing DNA strand, it will use sometimes dGTP and sometimes ddGTP. When ddGTP is used, the DNApol will no longer add nucleotides to the DNA strand. For ala3, write below three the possible molecules produced. For b1-b3, consider that you used ddATP...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing primer-binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. ddATP reaction ddTTP reaction ddCTP reaction ddGTP reaction What was the sequence of the DNA strand that acted as the template in the sequencing reaction? 5'ACGATCG 3' 5'TGCTAGC 3 5'CGATCGT3 5'GCTAGCA 3'