Question

1) You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template and based paired primer. Each tube has millions of these base paired constructs.

5’ - CTAGTACTGA

3’ - GATCATGACTAGACTTTGGACTAGCTACAAAGTACGAGTAGAACTAGC

After allowing for DNA synthesis and after denaturing the double-strand DNA and after separating the single-strand DNA by size in a polyacrylamide gel with the A, T, G, and C tube contents in separate lanes, and after performing autoradiography, you detect bands in the A, T, G, and C lanes. In which lane do you expect to see the smallest band?

A) The A lane

B) The T lane

C) The G lane

D) The C lane

2)Both Illumina and PacBio sequencing are examples of 2nd generation or next-generation sequencing (NGS). Both involve DNA polymerase and the synthesis of a new DNA strand based on a template. Which technique removes unincorporated (unused) nucleotides before the next nucleotide is added to the growing polynucleotide?

B) Illumina

C) PacBio

Answer 1

1)The smallest band of newly synthesized strand will contain: primer sequence+a radiolabelled adjacent nucleotide complementary to the base in template strand i.e

5’ - CTAGTACTGAT 3'.

3’ - GATCATGACTAGACTTTGGACTAGCTACAAAGTACGAGTAGAACTAGC

Therefore smallest band will appear on the T lane.Hence option 4 is correct choice.

2)Illumina sequencing technology works in three basic steps: amplify, sequence, and analyze DNA.After each round of synthesis, non-incorporated molecules are washed away.Whereas PacBio is a single-molecule real-time sequencing is a parallelized single molecule DNA sequencing method.Hence the right answer is Illumina.