Question

Below is a sequence of double-stranded DNA that will be used as a template in the...

Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below.

Template DNA:

5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3'

3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5'

If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers would work as the other primer in PCR to produce a product that included the shaded region?

Select one:

a. 5’-ACACACACAC-3’

b. 5’-TTTTGATACAG-3’

c. 5’-TCAAAATGCC-3’

(will comment and upvote if correct answer)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

Primer which would work as the other primer in PCR to produce a product that included the shaded region are:

5'-TCAAAATGCC-3'

Because it is only primer that contains both start and stop codon sequence.

Hence,option(C) is correct.

Add a comment
Know the answer?
Add Answer to:
Below is a sequence of double-stranded DNA that will be used as a template in the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template...

    THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template Temperature is lowered After one round of PCR the number of double-stranded DNA molecules is doubled. TGG TCACTTTGGCAAIAGAATT Heat-stable DNA polymerase adds nucleotides to the 3' end of the primer Primer 1 Primer 2 Heated to 72°C 5 TGCCTGGCCCCATCACTTTGGCAA AGAATTC 5

  • You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to...

    You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...

  • Q1 The immediate template for PCR amplification is double stranded DNA. (True or False) Q2 A...

    Q1 The immediate template for PCR amplification is double stranded DNA. (True or False) Q2 A primer is a DNA oligonucleotide. (True or False) Q1 Denaturation of DNA double helix takes place at 96 C. (True or False) Q2 A primer is a single stranded DNA oligonucleotide. (True or False) Q1 16 doubled stranded DNA fragments are obtained from one DNA double stranded template after 4 cycles of PCR. (True or False) Q2 Denaturation of DNA double helix takes place...

  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence...

    Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below. 5'-CCACTAGGGAGCTACGTAGGCACGGCATTACACGGATAGGCATTAACG-3' 3'-GGTGATCCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGTAATTGC-5' Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below 5'-CCACTAGGGAGCTACGTAGGCACGGCATTACACGGATAGGCATTAACG-3 3'-GGTGATCCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGTAATTGC-5 5'-CCACTAG-3'; 5'-CGTTAAT-3' 5'-GGTGATC-3'; 5'-GCAATTA-3' 5'-GATCACC-3':5'-CGTTAAT-3' 5'-CCACTAG-3';5'-GCAATTA-3' 5'-GGTGATC-3';5'-CGTTAAT-3'

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence...

    Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below.   5'-GGTGATCGGAGCTACGTAGGCACGGCATTACACGGATAGGCTAATTGC-3'   3'-CCACTAGCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGATTAACG-5' 5'-CCACTAG-3' ; 5'-GCAATTA-3' 5'-GATCACC-3' ; 5'-CGTTAAT-3'    5'-GGTGATC-3' ; 5'-GCAATTA-3' 5'-CCACTAG-3' ; 5'-CGTTAAT-3' 5'-GGTGATC-3' ; 5'-CGTTAAT-3'

  • 1) What does PCR stand for and what does it do? a. Polymerase Chain Reaction; PCR...

    1) What does PCR stand for and what does it do? a. Polymerase Chain Reaction; PCR deletes DNA b. Polymerase Copying Repeats; PCR amplifies DNA c. Polymerase Copying Releats; PCR deletes DNA d. Polymerase Chain Reaction; PCR amplifies DNA 2) During gel electrophoresis, the DNA fragments are separated by ____ a. charge b. DNA fragments cannot be separated c. color d. size 3) Primers are a. double stranded DNA oligonucleotide (fragment) b. double stranded RNA oligonucleotide (fragment) c. single stranded...

  • Please help with all questions. I provided all the information that I have. The sequence below...

    Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc   1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT