Question

Q1 The immediate template for PCR amplification is double stranded DNA. (True or False) Q2 A...

Q1 The immediate template for PCR amplification is double stranded DNA. (True or False)

Q2 A primer is a DNA oligonucleotide. (True or False)

Q1 Denaturation of DNA double helix takes place at 96 C. (True or False)

Q2 A primer is a single stranded DNA oligonucleotide. (True or False)

Q1 16 doubled stranded DNA fragments are obtained from one DNA double stranded template after 4 cycles of PCR. (True or False)

Q2 Denaturation of DNA double helix takes place at 72 C. (True or False)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

I believe the correct answer to be:;

Q1 The immediate template for PCR amplification is double stranded DNA. (True or False)

FALSE, It is single stranded DNA molecule.

Q2 A primer is a DNA oligonucleotide. (True or False)

TRUE

Q1 Denaturation of DNA double helix takes place at 96 C. (True or False)

TRUE

Q2 A primer is a single stranded DNA oligonucleotide. (True or False)

TRUE

Q1 16 doubled stranded DNA fragments are obtained from one DNA double stranded template after 4 cycles of PCR. (True or False)

TRUE, As the number of DNA molecule doubles after each cycle.

Q2 Denaturation of DNA double helix takes place at 72 C. (True or False)

FALSE, as it occurs at 95 degree celcius.

feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.

Add a comment
Know the answer?
Add Answer to:
Q1 The immediate template for PCR amplification is double stranded DNA. (True or False) Q2 A...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • 2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...

    2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...

  • 1) What does PCR stand for and what does it do? a. Polymerase Chain Reaction; PCR...

    1) What does PCR stand for and what does it do? a. Polymerase Chain Reaction; PCR deletes DNA b. Polymerase Copying Repeats; PCR amplifies DNA c. Polymerase Copying Releats; PCR deletes DNA d. Polymerase Chain Reaction; PCR amplifies DNA 2) During gel electrophoresis, the DNA fragments are separated by ____ a. charge b. DNA fragments cannot be separated c. color d. size 3) Primers are a. double stranded DNA oligonucleotide (fragment) b. double stranded RNA oligonucleotide (fragment) c. single stranded...

  • A PCR reaction begins with 5 double stranded segment(s) of DNA. Part A: Estimate the number...

    A PCR reaction begins with 5 double stranded segment(s) of DNA. Part A: Estimate the number of double-stranded copies of DNA that are present after the completion of 15 amplification cycles? Part B: After 30 cycles?

  • Below is a sequence of double-stranded DNA that will be used as a template in the...

    Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...

  • THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template...

    THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template Temperature is lowered After one round of PCR the number of double-stranded DNA molecules is doubled. TGG TCACTTTGGCAAIAGAATT Heat-stable DNA polymerase adds nucleotides to the 3' end of the primer Primer 1 Primer 2 Heated to 72°C 5 TGCCTGGCCCCATCACTTTGGCAA AGAATTC 5

  • this is a bio lab question Page 1: Question 7 (0.1 points) Saved Q1 DNA polymerase...

    this is a bio lab question Page 1: Question 7 (0.1 points) Saved Q1 DNA polymerase commonly used for PCR is extracted from Escherichia coli. (True or False) Q2 Primers used for PCR are double stranded DNA oligonucleotides. (True or False) O Q1 is true Q2 is true O Q1 is true Q2 is false O Q1 is false Q2 is true

  • True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that...

    True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that encodes for ampicillin resistance. The ends produced by the endonuclease can be rejoined by a ligase, which closes the break in the hydrogen bonds formed by the complementary DNA nucleotides. Restriction recognition sites typically have a palindrome structure. During DNA ligation, DNA fragments with compatible sticky ends have a higher ligation efficiency than DNA fragments with blunt ends. PCR is a technique used to...

  • You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to...

    You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...

  • Suppose you start a PCR reaction with 3 copies of a double stranded DNA fragment. How...

    Suppose you start a PCR reaction with 3 copies of a double stranded DNA fragment. How many copies will be present after 4 replication cycles? a. 7 b. 64 c. 48 d. 24 e. 8

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT