Question

To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...

To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene.

The forward primer binds near the 5’ end to the complementary strand of the sequences shown below.

The sequence of the forward primer is: Agagtttgatcctggctcag

The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG

To find the primer in the sequence below, you must first take the complementary to the primer

Complementary sequence: ________________________________

Next you need to reverse the complementary sequence (as you were shown in lab). Write the reverse sequence here:_________________________________

0 0
Add a comment Improve this question Transcribed image text
Answer #1

To do the PCR, we used 2 universal brines that roughly match sequences near the 5 and 3 ends of the 165 & RNA gue. The forwar

Add a comment
Know the answer?
Add Answer to:
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...

    The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.

  • 1. Create the primers to amplify the gene of interest. 1. Below is almost the full...

    1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...

  • please help me!!!!!!!!! do both i need help Dz. You are creating PCR primers for the...

    please help me!!!!!!!!! do both i need help Dz. You are creating PCR primers for the DNA sequence pictured. If the given sequence is the plus strand, what would be the reverse primer? (Type the primer in 5' to 3' orientation without spaces) 5' GTACTGCCAT TCGTAACTGT GTACTCAAGT AATGCCTGTC CATCATGTAA ATTGCATGGC CCTGATTGGA TATGCCAAAG GCTTTTGCAA GTCCCCATAG GTACTGGACA GTAGTACGTT GTCCTGAGGC GCGCTATAGG GTCGAAACTG 3 Enter answer. D8 You are creating PCR primers for the DNA sequence pictured. If the given sequence is the plus...

  • S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...

    S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...

  • Please help with all questions. I provided all the information that I have. The sequence below...

    Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc   1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...

  • CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below...

    CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below to amplify the target region highlighter in pink (which could be an important gene such as insulin that you want to make many copies of). At this point, the double-stranded DNA has been heated so that the strands are now in a single-strand formation. Be sure to pay attention to the DNA sequence and the 5' 3'ends of the primers. 5' GG CCA A...

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • 1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2....

    1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2. Suppose you begin a PCR reaction with 1 piece of double stranded DNA. After 30 cycles of replication, how many pieces of double stranded DNA do you now have? 3. What would be the consequence of having too much DNA in the sample? Would it interfere with the PCR reaction? Why? 4. What happens during the annealing step of the PCR reaction? During the...

  • Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the...

    Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+. Incubate the reaction appropriately. 2. Degrade the RNA strand with base, leaving just the cDNA. 3. cDNA is produced, which is single-stranded and complementary to the RNA of interest. 4. Double-stranded DNA for the region of interest is produced. 5. Add two primers (one forward and one reverse)...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT