
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
Question 33 2 pts Which of the following statements about the process of DNA replication is true? It involves the enzyme DNA ligase, which corrects point mutations. It utilizes DNA polymerase, which catalyzes the reaction that adds a new nucleotide to the growing strand. The sequence on the new strand is always identical to one of the old parent strands. Adenine pairs with guanine, and cytosine pairs with thymine. Question 34 2 pts The DNA base...
A double-stranded DNA molecule of 175 base pairs long had (A+T/(G+C) = 0.75. How many adenine nucleotides are there in this DNA? 75 37.5 150
Part A
Which model shows the correct polarity of double-stranded
DNA?
Which model shows the correct polarity of double-stranded
DNA?
Part B
Which model shows the correct polarity between mRNA and the DNA
template during transcription?
Which model shows the correct polarity between mRNA and the DNA
template during transcription?
Part C
Which model shows the correct polarity between mRNA and tRNA
during translation?
Which model shows the correct polarity between mRNA and tRNA
during translation?
Part D
Interpret this...