3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products formed from this replication. Remember, in replication, each strand is copied into a new daughter strand. In your answer, indicate which strands are the new daughter strands (mark with D) and which strands are the already existing parent strands (mark with P as shown below). Label the 5’ and 3’ ends of all DNA. HINT: You should have 2 double-stranded DNA fragments after replication.
P: 5’ GAATCAGATACAT 3’
P: 3’ CTTAGTCTATGTA 5’
REPLICATION RULE:
When the parent strand replicate into daughter strand it forms the complementary base pairs that is A base pair with T and G base pair with T. Each parent strand give rise to a double-stranded daughter strand
first parent strand P: 5’ GAATCAGATACAT 3’
its daughter stand D: 5’ GAATCAGATACAT 3’
3' CTTAGTCTATGTA 5'
SECOND parent strand P: 3’ CTTAGTCTATGTA 5’
its daughter stand D: 3’ CTTAGTCTATGTA 5’
5'GAATCAGATACAT 3’
3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products...
Draw a figure of one double stranded DNA molecule that has initiated replication and produced two okazaki fragment in each lagging strand. The figure must include both template strands, all newly synthesized DNA molecules on both leading and lagging strands, all RNA primers, direction of chain growth for each fragment/strand indicated with arrowheads, direction of replication forks. Each molecule must be labeled with the origin of replication on both strands, leading and lagging strands labeled, template or newly synthesized, DNA...
Q3: Shown below is a schematic of a replicating DNA in a cell. Arrows show the replication direction. (note that: The replication on the top strand is continuous while it is discontinuous on the bottom strand) a) On the diagram, label the 5' and the 3' ends (write in the boxes) of the parental DNA strands. b) On the diagram, label the 5' and 3' ends (write in the boxes) of the okazaki fragment. c) Why the DNA replication progresses...
During DNA replication, because each of the double stranded molecules of DNS consists of a single strand of old DNA (parent strand) and a single strand of new DNA (daughter strand), DNA replication is also known as: • A) Origin of replication • B) Replication bubble • C) Semi-conservative replication • D) All of the above
dentify the correct action and event for clamp loading proteins catalyzes the joining of deoxyribonucleotide 5 -triphosphates (dNTPs) to form the growing DNA chain O an enzyme that can synthesize short fragments of RNA de novo which are complementary to the parent strand template and serve as primers for DNA replication proteins that specifically recognize and bind DNA at the junction between the primer and template proteins that bind adjacent to the clamp-loading proteins, forming a ring around the template...
I am having trouble with the second question. Could you please
explain what the answer is and why? Thank you!
1. The drawings below show the Origin of Replication for double stranded DNA a) prior to the DNA replication bubble being opened, and, b) after the replication bubble has been formed, and replication has been going on for a while. The orientation of the DNA template is indicated. Origin of Replication ม ๆ Using lines with arrowheads, show the leading...
Complete each sentence to explain DNA replication.
three parent strand as the During DNA replication, the double-stranded DNA bonds connecting the parent strands are broken. hydrogen covalent An enzyme called is responsible for this step. DNA polymerase helicase New position themselves along the parent strands through nucleotides two The nucleotides are joined to each oth by an enzyme called complementary base pairing unwinds Now, new daughter DNA molecules are produced, each consisting of one old and one new rendering DNA...
DIN ANL and Protein Smith 6. Replicate each of the strands of DNA by moving the complementary nucleotides into place ONE AT A TIME, beginning at the end of each strand as shown in the photo 7. Compare the base sequences in the strands of these two new DNA molecules with each other, and also with the original strand. Are they identical molecules? 8. Point to the two strands of the original DNA molecule. Note that an original strand represents...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.
Matthew Meselson and Franklin Stahl performed an experiment using heavy isotopes and bacteria to determine which model DNA follows to replicate. Their results are evidence supporting which DNA replication model below? a. The parent DNA molecule is broken into its singular nucleotides from which new nucleotides are copied and then all nucleotides to come back together as one larger DNA molecule. b. The parent DNA is mixed into each of the daughter strands such that both daughter molecules contain a...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...