Question

During DNA replication, because each of the double stranded molecules of DNS consists of a single...

During DNA replication, because each of the double

stranded molecules of DNS consists of a single

strand of old DNA (parent strand) and a single strand

of new DNA (daughter strand), DNA replication is

also known as:

A) Origin of replication

B) Replication bubble

C) Semi-conservative replication

D) All of the above

0 0
Add a comment Improve this question Transcribed image text
Answer #1

During DNA replication because each of the double stranded molecules of DNA consists of a single strand of old DNA (parent strand) and a single strand of new DNA (daughter strand), DNA replication is also known as:

C. Semi conservative replication

This is known as semi conservative replication because an existing DNA strand is used to create a new strand and thus the conservation of the nucleotides of the old DNA strand occurs, as the 2 parental DNA strand is copied to form identical new nucleotides of the daughter DNA strand that match up with the two separated strands. So each DNA molecule contains one strand of the original DNA molecule (parental strand) and one newly synthesized strand (daughter strand) that results in the conservation of the old parental stand.

Add a comment
Know the answer?
Add Answer to:
During DNA replication, because each of the double stranded molecules of DNS consists of a single...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Complete each sentence to explain DNA replication. three parent strand as the During DNA replication, the...

    Complete each sentence to explain DNA replication. three parent strand as the During DNA replication, the double-stranded DNA bonds connecting the parent strands are broken. hydrogen covalent An enzyme called is responsible for this step. DNA polymerase helicase New position themselves along the parent strands through nucleotides two The nucleotides are joined to each oth by an enzyme called complementary base pairing unwinds Now, new daughter DNA molecules are produced, each consisting of one old and one new rendering DNA...

  • 3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products...

    3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products formed from this replication. Remember, in replication, each strand is copied into a new daughter strand. In your answer, indicate which strands are the new daughter strands (mark with D) and which strands are the already existing parent strands (mark with P as shown below). Label the 5’ and 3’ ends of all DNA. HINT: You should have 2 double-stranded DNA fragments after replication....

  • Draw a figure of one double stranded DNA molecule that has initiated replication and produced two...

    Draw a figure of one double stranded DNA molecule that has initiated replication and produced two okazaki fragment in each lagging strand. The figure must include both template strands, all newly synthesized DNA molecules on both leading and lagging strands, all RNA primers, direction of chain growth for each fragment/strand indicated with arrowheads, direction of replication forks. Each molecule must be labeled with the origin of replication on both strands, leading and lagging strands labeled, template or newly synthesized, DNA...

  • The process of DNA replication yields two identical DNA molecules from a single double-stranded molecule. Cellular...

    The process of DNA replication yields two identical DNA molecules from a single double-stranded molecule. Cellular proof-reading and error-checking mechanisms ensure nearly perfect fidelity of the DNA copies. However, RNA viruses lack replication error-checking mechanisms, and thus have higher rates of genetic variation. Discuss the importance of error-checking mechanisms during replication and how in the absence of these mechanisms genetic variation is introduced.

  • 2. DNA REPLICATION. Fill in the blank and give a definition for DNA Replication a) DNA...

    2. DNA REPLICATION. Fill in the blank and give a definition for DNA Replication a) DNA replication is the basis for which is a fundamental process that occurs in all living organisms which copies their DNA for cach cell and in order to produce offspring. In the process of DNA Replication each c) Following DNA replication, two identical DNA molecules have been produced from a single double-stranded DNA molecule. Label the diagram. DNA REPLICATION 2000woods wood 20000000s: x200000k: d) WHEN...

  • The process of DNA replication yields two identical DNA molecules from a single double-stranded molecule. Cellular proof-reading and error-checking mechanisms ensure nearly perfect fidelity of the DNA...

    The process of DNA replication yields two identical DNA molecules from a single double-stranded molecule. Cellular proof-reading and error-checking mechanisms ensure nearly perfect fidelity of the DNA copies. However, RNA viruses lack replication error-checking mechanisms, and thus have higher rates of genetic variation. Discuss the importance of error-checking mechanisms during replication and how in the absence of these mechanisms genetic variation is introduced.

  • DIN ANL and Protein Smith 6. Replicate each of the strands of DNA by moving the...

    DIN ANL and Protein Smith 6. Replicate each of the strands of DNA by moving the complementary nucleotides into place ONE AT A TIME, beginning at the end of each strand as shown in the photo 7. Compare the base sequences in the strands of these two new DNA molecules with each other, and also with the original strand. Are they identical molecules? 8. Point to the two strands of the original DNA molecule. Note that an original strand represents...

  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

  • 5:47 Done Attachment 14. (5 points). DNA replicates according to the Semi-Conservative model. In the space...

    5:47 Done Attachment 14. (5 points). DNA replicates according to the Semi-Conservative model. In the space below, draw 2 straight parallel lines representing an original double stranded DNA molecule. NOTE: parallel lines can be drawn using the underline" feature in Word Then draw straight parallel lines representing 2 new DNA molecules after replication of the original molecule according to the Semi-Conservative model. Indicate old vs. new DNA strands You can distinguish between the strands by typing the word "old" beside...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT