Question

Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or several of their paws. It results from a mutation in Gene T. Section of the wild type and polydactyly alleles contain the following sequence:

• Wild type Allele (T):

AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAAGCTTAGGTAGGTAGTTCGTA

• Polydactyly Allele (t):

AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAATCTTAGGTAGGTAGTTCGTA

You are a geneticist and would like to test a litter of kittens. After isolating the DNA, you plan to cut it with a restriction enzyme and run the fragments on an electrophoresis gel. You have the choice between the two following restriction enzymes:

EcoRI G|AATTC

HindIII A|AGCTT

1. Which enzyme would you choose?

You obtained the gel below. We know that Minou is normal:

Jackie Minou Shadow Madie Bonnie Roxy -- ---

2. Specify the genotype of each cat in the table below. (remember that males are hemizygous for X-linked genes)

Cat	Genotype	Phenotype
Jackie
Minou
Shadow
Madie
Bonnie
Roxy

3. Roxy is Jackie’s offspring, but could it be Minou’s? Yes/No
4. What would be the genotype of Roxy’s father and his phenotype?

Answer 1

Answering in the order of questions been asked:

1. Hind III will be the enzyme of choice because gene sequence analysis shows that the cut site of this enzyme lies in the mutation site, this will give advantage for analysis as mutated site will lose cut site and it can be observed in the gel on the basis of fragment site. Therefore it will be easy for identification.
2. Genotype and phenotype of the offspring are as follows.

Cat	Genotype	Phenotype
Jackie	Tt	Wild type
Minou	TT	Wild type
Shadow	TT	Wild type
Madie	Tt	Wild type
Bonnie	Tt	Wild type
Roxy	tt	Polydactyly

3. No, If Roxy is Jackie’s offspring then Minou should not be her father, as Minou is normal in trait. For Roxy to be positive for the trait her father should have the same trait. In X-linked recessive disorders father can never be the carrier, he should be diseased to pass on the trait.
4. Roxy’s father will genotype “ Tt ” and phenotype will be Polydactyly