Question

Consider the protease chymotrypsin. a. What is its normal catalytic activity? b. Can it catalyze the...

Consider the protease chymotrypsin. a. What is its normal catalytic activity? b. Can it catalyze the formation of peptide bonds? Why or why not? c. Does it do so normally in the body? Why or why not?

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Consider the protease chymotrypsin. a. What is its normal catalytic activity? b. Can it catalyze the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 4. Consider the protease chymotrypsin. a. What reaction does it normally catalyze? b. Can it...

    Question 4. Consider the protease chymotrypsin. a. What reaction does it normally catalyze? b. Can it catalyze the formation of peptide bonds? Why or why not? c. Where is chymotrypsin active in the body? Can it catalyze formation of peptide bonds in this location? Why or why not?

  • Please answer section a thru c: 11. Chymotrypsin is a protease, an enzyme that cleaves peptide...

    Please answer section a thru c: 11. Chymotrypsin is a protease, an enzyme that cleaves peptide bonds. a) At pH 2, the enthalpy and entropy of denaturation for chymotrypsin are +418 kJ/mol and +1.32 kJ/mol respectively. Calculate the melting temperature for chymotrypsin. b) Chymotrypsin inhibitor (CI) is a small protein that binds to chymotrypsin with high affinity and prevents protease activity. The dissociation constant for Chymo-CI is 110 PM in a salt free solution. What is the Gibbs free energy...

  • 1) (10 pts) Serine proteases are enzymes that cleave peptide bonds in proteins. Explain using words...

    1) (10 pts) Serine proteases are enzymes that cleave peptide bonds in proteins. Explain using words (drawings OR both) why serine proteases cleave either before or after different amino acid residues. Talk about at least two of the following proteases: Chymotrypsin, Trypsin, or Elastase. mod 2) (10pts) Below is a hypothetical peptide sequence. Give the peptide fragments that will occur by enzymatic degradation using Trypsin and Chymotrypsin DARSKWKSENLIRTY 3) (10 pts) All superfamilies of serine proteases use the catalytic triad...

  • Under typical conditions, many essential biochemical reactions proceed so slowly that life could not exist without...

    Under typical conditions, many essential biochemical reactions proceed so slowly that life could not exist without the presence of enzymes. Enzymes increase reaction rates through a wide variety of mechanisms. These mechanisms generally utilize the following strategies: improving the nucleophiles and electrophiles present in the catalytic R groups or substrates; stabilizing the extra electron density of the leaving group; and stabilizing transition states. Proteases are enzymes that break down proteins by hydrolyzing peptide bonds. Chymotrypsin is a protease found in...

  • 1. Enzymes catalyze reactions by diverse mechanisms, frequently involving multiple steps. Consider the well-studied enzyme called...

    1. Enzymes catalyze reactions by diverse mechanisms, frequently involving multiple steps. Consider the well-studied enzyme called chymotrypsin, which has three amino acids in its active site: Asp102, His 57, and Ser 195. What is the catalytic role of His 57? A. covalent catalysis B. general acid-base C. catalysis catalysis by approximation D. metal ion catalysis 2. Which of the following functional groups are not found in carbohydrates? A. aldehydes B. hydroxyls C. ketones D. thiols 3. What are the components...

  • 2. hypothesize the best conditions (pH and temperature) under which the enzyme chymotrypsin functions with an...

    2. hypothesize the best conditions (pH and temperature) under which the enzyme chymotrypsin functions with an appropriate reference. also, hypothesize what will occur in the presence of an inhibitor and the type of inhibition. EXPERIMENT 5: ENZYME ACTIVITY WITH a-CHYMOTRYPSIN Prelab Assignment 1. Prepare a flow chart, covering one half of the experimental work (either part A and C if your lab bench is on the window side of the lab or part B and D if your locker is...

  • The catalytic reaction A+C D , can be adequately described by the following mechanism: A B...

    The catalytic reaction A+C D , can be adequately described by the following mechanism: A B (with ki = forward rate constant, k-1 = backward rate constant) B+C D (with rate constant k) Use the quazi (pseudo) steady state approach to find the rate of formation of D. Consider the following liquid phase catalytic reaction: A+B → C. The reaction has been found to follow the mechanism: A+D AD (very fast) AD +BBAD BAD→D+C (very fast) The rate of reaction...

  • These can be computed exactly using the normal distribution. Please show all working 6. Consider the...

    These can be computed exactly using the normal distribution. Please show all working 6. Consider the following project network and activity times (in weeks): Start Finish Activity | A BC DEFG H Time 15 376 73 10 8 a. b. c. Identify the critical path. How much time will be needed to complete this project? Can activity D be delayed without delaying the entire project? If so, by how many weeks? d. Can activity C be delayed without delaying the...

  • Any help would be appreciated! S y of a protease activity of Science you decided to...

    Any help would be appreciated! S y of a protease activity of Science you decided to develop a series of peptide sequence to probe sequence versus activity profiles. boa experimenting the lo n g e sequence versus activity profiles You deseo DNA plecamid sequence entire plasmid not shown-just the ce desired Answer the e plasmid not show-just the site of interest and DNA questions using these sequences (24 pts) Plasmid Sequence (selected insert portion)" TCGAGCCGATATCCTGCAGCGATGAAGCTTGOTAGOGTCGACTAACACTGCAGOTCOACCO AGCGCTATAGGACOTCGCTACTTCGAACCATCGCAGCTGATTGTGACGTCCAGAR rege Althe t he...

  • please help! I'm just starting peptides this week, so I'm really lost. Question 1. Consider the...

    please help! I'm just starting peptides this week, so I'm really lost. Question 1. Consider the small peptide Pro-Cys-Arg-Gln (a) Draw the entire peptide (careful of peptide bonds!), with charges you would expect on it at pH 7.4. Hint: how many ionizable groups on this peptide? (b) Tabulate the charge on the molecule at every pH between 1 and 13 (c) Calculate the pI for the peptide. What is the overall charge on the peptide at pH 1? pH 7.4?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT