Question
In python

Write a function called removeExtensión that is given the name of a file as a string and returns the same string without the extension (the last and any following characters); if the given string has no extension, return the given string without changing it. For example, removeExtensionChapter 3.9.txt) should return Chapter 3.9 while removeExtension(Hello) should return Hello
0 0
Add a comment Improve this question Transcribed image text
Answer #1
Please find below the code :

def removeExtension(file):
   """
   function to remove extension
   if more than one . then it will remove last extension after
   .
   :param file:
   :return:
   """
   file = file.rsplit(".",1)
   return file[0]
#calling the above function
print(removeExtension("Chapter3.9.txt"))
print(removeExtension("Hello"))

#OUTPUT

Chapter3.9
Hello

Add a comment
Know the answer?
Add Answer to:
In python Write a function called removeExtensión that is given the name of a file as...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • PYTHON 4. Define a function that takes two arguments: a string called strText and a number...

    PYTHON 4. Define a function that takes two arguments: a string called strText and a number called intNumber. This function will use a repetition structure (a While or For loop) to print strText intNumber of times. Call this function. 5. Get an input from the user that is a file name with an extension (e.g., "myfile.ipynb" or "myfile.txt"). Print only the characters that follow the "." in the file name (e.g., "ipynb" and "txt"). 6. Ask the user for 5...

  • 5. Write a Python function called readlinesmton that accepts the name of the file (i.e. filename),...

    5. Write a Python function called readlinesmton that accepts the name of the file (i.e. filename), starting line number i.e. m) and ending line number (i.e. n) as a parameter. The function then returns the contents from line number m to n (m <n). If m < 1 then start from line 1. Similarly, if n > number of lines the file, then stop at the last line in the file. Sample Input: readlinesmton("data.txt",5,7) Sample Input: readlinesmton("data.txt", 0,10)

  • PYTHON: Write a function that takes, as an argument, the name of a file, fileName, and...

    PYTHON: Write a function that takes, as an argument, the name of a file, fileName, and an integer n between -750 and 750 (inclusive). Your program should verify that n is an integer in the correct range. If it is not, it should return the string “Your integer is out of range.” If it is in the correct range, your program should open (and read through) the file specified, and return the number of values in the file that are...

  • Python Function Name: unscramble Parameters: a string Returns: a string Description: Write a function, unscramble, that...

    Python Function Name: unscramble Parameters: a string Returns: a string Description: Write a function, unscramble, that takes an input string, and returns a the unscrambled version of the argument. To unscramble the string: When the string has an odd number of characters, middle character is the first character in the unscrambled result Pairs of remaining characters are added to the result, proceeding left to right from inner-most to outer-most characters. Example Call: unscramble('3cis1') Expected result: ics31 Example Call: unscramble('ocicssol') Expected...

  • Write a Python function called more() that takes three string inputs and outputs a string Formally,...

    Write a Python function called more() that takes three string inputs and outputs a string Formally, the function signature and output are given by rucharist, char: str words str) > str Use the same names for the input arguments as shown above Note that charl and char2 will always be a string of length 1 (ie, it is a single character. The function checks which of charl or char2 appears more often in the word string and returns that character...

  • Python File Compression: Write a function called “compressString” which compresses a string such that any consecutive...

    Python File Compression: Write a function called “compressString” which compresses a string such that any consecutive repeated characters are replaced with one of the character and the number of times the character is repeated. This is also known as "Run length encoding". Examples:“aaabbc” -> “a3b2c”“abc” -> “abc”“aaqakkaccc” -> a2qak2a2c3

  • Python 3.0 Please Write a function that takes, as arguments, a binary string, a list of...

    Python 3.0 Please Write a function that takes, as arguments, a binary string, a list of characters and the corresponding Huffman code for those characters. It decodes the binary string using the Huffman code, and returns the resulting decoded string. Name this function decodeStringHuffman(binaryString, myCharacters, myCode). For example, >>>decodeStringHuffman("1001100010111010101010111", ["A", "B", "C"], ["1", "00", "01"]) should return the string 'ABAABCCAACCCCCAA'

  • Python: Using chr() and ord() write a function called en_crypt() that takes into input a string...

    Python: Using chr() and ord() write a function called en_crypt() that takes into input a string and returns a new encrypted version of the input string. Example: "atwOta@0202" should return "fy|TyfE5757", then write a function de_crypt() so that "fy|TyfE5757" returns "atwOta@0202"

  • I'm a bit confused on how to get this program to run right. Here are the...

    I'm a bit confused on how to get this program to run right. Here are the directions: Part 1: Write a Python function called reduceWhitespace that is given a string line and returns the line with all extra whitespace characters between the words removed. For example, ‘This line has extra space characters ‘  ‘This line has extra space characters’ Function name: reduceWhitespace Number of parameters: one string line Return value: one string line The main file should handle the...

  • In python Attached is a file called sequences.txt, it contains 3 sequences (one sequence per line)....

    In python Attached is a file called sequences.txt, it contains 3 sequences (one sequence per line). Also attached is a file called AccessionNumbers.txt. Write a program that reads in those files and produces 3 separate FATSA files. Each accession number in the AccessionNumbers.txt file corresponds to a sequence in the sequences.txt file. Remember a FASTA formatted sequence looks like this: >ABCD1234 ATGCTTTACGTCTACTGTCGTATGCTTTACGTCTACTGACTGTCGTATGCTTACGTCTACTGTCG The file name should match the accession numbers, so for 1st one it should be called ABCD1234.txt. Note:...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT