Homework Answers
Answer. The answer is E). Termination molecule.
Reason: In the bacterial system there are two different types of transcription termination processes. Rho-independent and Rho-dependent. In case of Rho-dependent mechanism, the RNA contains a binding site for a protein called Rho factor. Rho factor or the termination molecule binds to this sequence and pulls the RNA transcript and the template DNA strand apart, releasing the RNA molecule and ending transcription.
Add Answer to:
where or how does s nthesiserid. AStop codoN 0 poly A's od tumplata ON tury out...
phe 24 with poly- U ONO enylalanine polymerized no poly-V URI 0 0 10 20 30...
phe 24 with poly- U ONO enylalanine polymerized no poly-V URI 0 0 10 20 30 40 50 60 70 80 time (min) How do the data in Figure 2.21A support linking the codon UUU to the amino acid phenylalanine? These data support that you need a codon of three nucleotides to code for 1 amino acid. When ribosomes, poly-U. RNA, and amino acids were mixed, short sequences of phenylalanine amino acids were synthesized. When ribosomes, mRNA, TRNA, and phenyialanine...
0 no poly U 240 0 0. 0 999 0 10 20 30 40 50 60...
0 no poly U 240 0 0. 0 999 0 10 20 30 40 50 60 70 80 time (min) How do the data in Figure 2.21A support linking the codon UUU to the amino acid phenylalanine? These data support that you need a codon of threenucleotides to code for 1 amino a When ribosomes, poly-u, tRNA, and amino acids were mixed, short sequences of phenylalanine amino acids were synthesized. When ribosomes, mRNA, TRNA, and phenylalanine were mixed, short sequences...
Where does RNA polymerase bind during transcription? A. Inducer B. Operator C. Start Codon D. Promoter
Where does RNA polymerase bind during transcription? A. Inducer B. Operator C. Start Codon D. Promoter
where does transcription begin 3. List the major types of RNA and include what they code...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
1a. Explain how bacteria can have poly cistronic mRNAs. 1b. Explain why eukaryotes don't have poly...
1a. Explain how bacteria can have poly cistronic mRNAs. 1b. Explain why eukaryotes don't have poly cistronic mRNAs. 2. Draw all the parts of a typical sliced out mRNA lariat, showing the donor (gu) and acceptor (ag) nucleotides, and the conserved branch point A. Indicate any unusual base pair linkages and explain where and what they are (arrows and a few words!). 3. Give the levels of B-galactosidase activity (+ or -) expected for the following partial diploids for the...
QUESTION 1 How many total valence electrons are there in one ion of thiosulfate, S,0,-7 OA....
QUESTION 1 How many total valence electrons are there in one ion of thiosulfate, S,0,-7 OA. 32 OB. 30 C. 28 OD. 26 OE. 7 QUESTION 2 Choose the best Lewis structure for Xel 2. CA I-Xe-i: oc - Xe CD. G=Xe=: CE :=Xe=; QUESTION 3
What does that mean that these equations aren't CLOSED? 0t OD (ii) V B-0,
What does that mean that these equations aren't CLOSED?
0t OD (ii) V B-0,
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Why does the equation AgNO3 + Zn balance out to be Zn(NO3)2 + Ag? where did...
Why does the equation AgNO3 + Zn balance out to be Zn(NO3)2 + Ag? where did the (NO3)2 come from? How are there suddenly TWO NO3's? Neither Ag or Zn have charges so how was another NO3 derived? Thank you.
Find the Laplace transform of the function f(t) = t, 0 <t<1 1, t>1 s e...
Find the Laplace transform of the function f(t) = t, 0 <t<1 1, t>1 s e ОА 52 e-(s-1) OB S $2 1- e-s ос. $2 S OD S 1-e OE S
phe 24 with poly- U ONO enylalanine polymerized no poly-V URI 0 0 10 20 30 40 50 60 70 80 time (min) How do the data in Figure 2.21A support linking the codon UUU to the amino acid phenylalanine? These data support that you need a codon of three nucleotides to code for 1 amino acid. When ribosomes, poly-U. RNA, and amino acids were mixed, short sequences of phenylalanine amino acids were synthesized. When ribosomes, mRNA, TRNA, and phenyialanine...
0 no poly U 240 0 0. 0 999 0 10 20 30 40 50 60 70 80 time (min) How do the data in Figure 2.21A support linking the codon UUU to the amino acid phenylalanine? These data support that you need a codon of threenucleotides to code for 1 amino a When ribosomes, poly-u, tRNA, and amino acids were mixed, short sequences of phenylalanine amino acids were synthesized. When ribosomes, mRNA, TRNA, and phenylalanine were mixed, short sequences...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
1a. Explain how bacteria can have poly cistronic mRNAs. 1b. Explain why eukaryotes don't have poly cistronic mRNAs. 2. Draw all the parts of a typical sliced out mRNA lariat, showing the donor (gu) and acceptor (ag) nucleotides, and the conserved branch point A. Indicate any unusual base pair linkages and explain where and what they are (arrows and a few words!). 3. Give the levels of B-galactosidase activity (+ or -) expected for the following partial diploids for the...
QUESTION 1 How many total valence electrons are there in one ion of thiosulfate, S,0,-7 OA. 32 OB. 30 C. 28 OD. 26 OE. 7 QUESTION 2 Choose the best Lewis structure for Xel 2. CA I-Xe-i: oc - Xe CD. G=Xe=: CE :=Xe=; QUESTION 3
What does that mean that these equations aren't CLOSED?
0t OD (ii) V B-0,
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Find the Laplace transform of the function f(t) = t, 0 <t<1 1, t>1 s e ОА 52 e-(s-1) OB S $2 1- e-s ос. $2 S OD S 1-e OE S
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago