import random
def lengthToATG():
count = 0
seq = ''
string = 'ACTG'
while True:
count += 1
seq += string[random.randint(0, len(string)-1)]
if seq.endswith('ATG'):
break
return count
def meanToATG(trials):
total = 0
for i in range(trials):
total += lengthToATG()
return total/trials
print(meanToATG(100))

Use python! Average length to an ATG Please put all of your code for this problem...
Please use the JAVA code attached as an input to the program
that must be created IN JAVA.
Instructions of the program:
java code:
/*
* To change this license header, choose License Headers in Project Properties.
* To change this template file, choose Tools | Templates
* and open the template in the editor.
*/
/**
*
*/
import java.util.Random;
public class Rand_Z3_Exp {
/**
* @param args the command line arguments
*/
public static void main(String[] args) {...
Please use the JAVA code attached as an input to the program
that must be created IN JAVA.
Instructions of the program:
java code:
/*
* To change this license header, choose License Headers in Project Properties.
* To change this template file, choose Tools | Templates
* and open the template in the editor.
*/
/**
*
*/
import java.util.Random;
public class Rand_Z3_Exp {
/**
* @param args the command line arguments
*/
public static void main(String[] args) {...
Create a NOTEPAD or PDF file that restates the problem in your own words, specifies what input is needed, what output is expected, the step by step process (algorithm) to get the output from the input, and test data (input for which you know the expected output) for each of the 3 problems given below. You should not write any actual C++ code. Make sure the problem statement is in your own words and is descriptive enough so someone not...
Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...
!!!!!!!Java!!!!! When you are confident that your methods work properly and that you can generate random text with my generateText method, you can move on to the second step. Create a third class called Generator within the cs1410 package. Make class. This class should have a main method that provides a user interface for random text generation. Your interface should work as follows: Main should bring up an input dialog with which the user can enter the desired analysis level...
Please help as it is very important task for me please write in Python code and divide this into function and write comments for it 1. Ask the player’s name and welcome them to the game using their name. 2. Ask the player what is par for this game (number between 3-5 inclusive) 3. Ask the player what the distance to the hole for this game is (whole number between 195 and 250 inclusive) 4. Show the game menu: (I)nstructions...
Coding for Python - The pattern detection problem – part 2:
def calculate_similarity_list(data_series,
pattern)
Please do not use 'print' or 'input'
statements.
Context of the assignment is:
In this assignment, your goal is to write a Python program to
determine whether a given pattern appears in a data series, and if
so, where it is located in the data series. Please see attachments
below:
We need to consider the following cases:
Case 1 - It is possible that the given...
Please write a BASH Script in LINUX that... 1. is actually executable 2. has a comment to tell us what you did, why and how. 3. allows a user to enter their name and a number between 1 than 100 (this must be prompted so the user knows what to do) 4. creates a random number between 1 and 100 for you to guess. The command to create a random number is shown below. (if you find a better one...use...
import java.util.Arrays; import java.util.Random; import java.util.Scanner; /** * TODO Write a summary of the role of this class in the * MasterMind program. * * @author TODO add your name here */ public class MasterMind { /** * Prompts the user for a value by displaying prompt. * Note: This method should not add a new line to the output of prompt. * * After prompting the user, the method will consume an entire * line of input while reading...
Using C++ in Visual Studios
Rewrite the code to use a Stack instead of a Queue. You will
need to think about the differences in the Stack and Queue. Think
about how they operate and how the nodes may differ.
Modify the code as necessary.
You will need to push to the Stack, pop from the Stack, peek at
the Stack. You will need a member functions like in the example
code. Your program will need to show that everything...