Question
Use python!

Average length to an ATG Please put all of your code for this problem in a file called lengthTOATG.py Lets assume that we have a long DNA sequence in which each symbol is random and equally likely to be an A, C, T, or G. Wed like to determine the average number of symbols until we see the first occurrence of a start codon ATG Once youve written a function to compute this, youll do the same thing to find the average number of symbols until we see the first occurrence of the codon AAA Surprisingly, the average for ATG and the average for AAA are not the same! Well break this task up into a few parts lengthToATG() First, write a function called lengthTOATG( ) that takes no input, generates a random letter from·A, T, C, or G, and then if the last three letters generated are ATG, it returns the total number of symbols that were generated. Otherwise, it repeats the process by generating a next random letter Recall that in order to generate things at random, you simply include the line... import randon T, 叱· 6) to generate a random symbol from the list t , , , . at the top of your file. Then, you can use random. choice(A, Clearly, youll need to have a loop to keep generating symbols untl we see the pattern ATG. Since we dont know in advance how many symbols wll need to be generated before we see this pattern, a while loop is the right choice
media%2F0eb%2F0ebad565-6cf0-4ccf-a43e-8f
0 0
Add a comment Improve this question Transcribed image text
Answer #1
import random


def lengthToATG():
    count = 0
    seq = ''
    string = 'ACTG'
    while True:
        count += 1
        seq += string[random.randint(0, len(string)-1)]
        if seq.endswith('ATG'):
            break
    return count


def meanToATG(trials):
    total = 0
    for i in range(trials):
        total += lengthToATG()
    return total/trials


print(meanToATG(100))

1.6 Process finished with e xit code 0

Add a comment
Know the answer?
Add Answer to:
Use python! Average length to an ATG Please put all of your code for this problem...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please use the JAVA code attached as an input to the program that must be created...

    Please use the JAVA code attached as an input to the program that must be created IN JAVA. Instructions of the program: java code: /* * To change this license header, choose License Headers in Project Properties. * To change this template file, choose Tools | Templates * and open the template in the editor. */ /** * */ import java.util.Random; public class Rand_Z3_Exp { /** * @param args the command line arguments */ public static void main(String[] args) {...

  • Please use the JAVA code attached as an input to the program that must be created IN JAVA. Instru...

    Please use the JAVA code attached as an input to the program that must be created IN JAVA. Instructions of the program: java code: /* * To change this license header, choose License Headers in Project Properties. * To change this template file, choose Tools | Templates * and open the template in the editor. */ /** * */ import java.util.Random; public class Rand_Z3_Exp { /** * @param args the command line arguments */ public static void main(String[] args) {...

  • Create a NOTEPAD or PDF file that restates the problem in your own words, specifies what input is needed, w...

    Create a NOTEPAD or PDF file that restates the problem in your own words, specifies what input is needed, what output is expected, the step by step process (algorithm) to get the output from the input, and test data (input for which you know the expected output) for each of the 3 problems given below. You should not write any actual C++ code. Make sure the problem statement is in your own words and is descriptive enough so someone not...

  • Please Complete the following C Code with Comments explaining your solution and post a screenshot of...

    Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...

  • !!!!!!!Java!!!!! When you are confident that your methods work properly and that you can generate random...

    !!!!!!!Java!!!!! When you are confident that your methods work properly and that you can generate random text with my generateText method, you can move on to the second step. Create a third class called Generator within the cs1410 package. Make class. This class should have a main method that provides a user interface for random text generation. Your interface should work as follows: Main should bring up an input dialog with which the user can enter the desired analysis level...

  • Please help as it is very important task for me please write in Python code and...

    Please help as it is very important task for me please write in Python code and divide this into function and write comments for it 1. Ask the player’s name and welcome them to the game using their name. 2. Ask the player what is par for this game (number between 3-5 inclusive) 3. Ask the player what the distance to the hole for this game is (whole number between 195 and 250 inclusive) 4. Show the game menu: (I)nstructions...

  • Coding for Python - The pattern detection problem – part 2: def calculate_similarity_list(data_series, pattern) Please do not use 'print' or 'input' statements. Context of the assignme...

    Coding for Python - The pattern detection problem – part 2: def calculate_similarity_list(data_series, pattern) Please do not use 'print' or 'input' statements. Context of the assignment is: In this assignment, your goal is to write a Python program to determine whether a given pattern appears in a data series, and if so, where it is located in the data series. Please see attachments below: We need to consider the following cases: Case 1 - It is possible that the given...

  • Please write a BASH Script in LINUX that... 1. is actually executable 2. has a comment...

    Please write a BASH Script in LINUX that... 1. is actually executable 2. has a comment to tell us what you did, why and how. 3. allows a user to enter their name and a number between 1 than 100 (this must be prompted so the user knows what to do) 4. creates a random number between 1 and 100 for you to guess. The command to create a random number is shown below. (if you find a better one...use...

  • import java.util.Arrays; import java.util.Random; import java.util.Scanner; /** * TODO Write a summary of the role of...

    import java.util.Arrays; import java.util.Random; import java.util.Scanner; /** * TODO Write a summary of the role of this class in the * MasterMind program. * * @author TODO add your name here */ public class MasterMind { /** * Prompts the user for a value by displaying prompt. * Note: This method should not add a new line to the output of prompt. * * After prompting the user, the method will consume an entire * line of input while reading...

  • Using C++ in Visual Studios Rewrite the code to use a Stack instead of a Queue....

    Using C++ in Visual Studios Rewrite the code to use a Stack instead of a Queue. You will need to think about the differences in the Stack and Queue. Think about how they operate and how the nodes may differ.   Modify the code as necessary. You will need to push to the Stack, pop from the Stack, peek at the Stack. You will need a member functions like in the example code. Your program will need to show that everything...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT