Question

Which of the following DNA sequences corresponds to the peptide sequence MSQHNEKNPH Select one or more: a. atgtaacagcatccagaaaaaaagtattga O b. atgtcccaacatgataagaacttcaaccat □ catgagccaggcagttatagaaaaaccgcat datgagccagcataacgaaaaaaacccgcat
0 0
Add a comment Improve this question Transcribed image text
Answer #1

amino acid in letters- MSQHNEKNPH

amino acids expanded- met ser gln his asn glu lys asn pro his

RNA sequence- AUG AGU CAA CAU AAU GAA AAA CCU CAU

DNA sequence- TAC TCA GTT GTA TTA CTT TTT GGA GTA

complementry sequence -ATG AGT CAA CAT AAT GAA AAA CCT CAT

ans . is c or d.

Add a comment
Know the answer?
Add Answer to:
Which of the following DNA sequences corresponds to the peptide sequence MSQHNEKNPH Select one or more:...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A peptide has the sequence NH2-valine-tyrosine-lysine-leucine- COOH. Which of the following sequences in template DNA could...

    A peptide has the sequence NH2-valine-tyrosine-lysine-leucine- COOH. Which of the following sequences in template DNA could code for this peptide? a. 5'-GUU-UAU-AAA-CUU-3’ b. 3'-GUU-UAU-AAA-CUU-5’ c. 3’-CAA-ATA-TTT-GAA-5’ d. 5’-CAA-ATA-TTT-GAA-3’ e. None of the above

  • The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...

    The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5- TTATTCTTTAAT CAT-3 What would be the consequences of the highlighted A to be mutated to a G? Select one: a. The resulting peptide will likely be larger than the non-mutant peptide b. the primary sequence of the peptide will be different on one amino acid O C. The peptide sequence would be the same d. all the amino acids after...

  • The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...

    The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5'- TTATTCTTTAAT CAT-3' What would be the consequences of the highlighted A to be mutated to a G? Select one: a. the primary sequence of the peptide will be different on one amino acid b. all the amino acids after the mutation will be different than the non-mutant peptide c. The peptide sequence would be the same d. The resulting peptide...

  • Which of the DNA sequences below contain(s) a palindrome? Select as many as apply. Sequence 1:...

    Which of the DNA sequences below contain(s) a palindrome? Select as many as apply. Sequence 1:     TTTTAAAA Sequence 2:     GGAATTCC Sequence 3:     GGAAGGAA Sequence 4:     GGAAAAGG

  • 42. Which is correct about the peptide elongation by ribosome? Select one: a. Addition of a...

    42. Which is correct about the peptide elongation by ribosome? Select one: a. Addition of a new amino acid is achieved by peptide transfer from the A site tRNA to the P site URNA. b. Translation is not affected by the cellular availability of GTP. O c. Peptide bond formation is catalyzed by enzymatic proteins in ribosome. O d. The peptide bond is formed by a nucleophilic attack of the A-site NH2- onto the P-site -COOH. O e. None of...

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume...

    using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

  • Which of the following are macromolecules composed of one or more polypeptides covalently linked by peptide...

    Which of the following are macromolecules composed of one or more polypeptides covalently linked by peptide bonds? Select one or more: Cellulose Casein Amylase peroxidase dextran Gelatin

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT