Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a...

Question

Question

Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a text on the alphabet A, C, G,

engineering Computer-Science

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

A)//Suffiix table

0	1	2	3	4	5	6	7	8	9	10
9	9	9	9	9	9	9	9	3	1	2

B)At each step we will find match subpatter in pattern and text.Then we will search suffix of subpattern in given pattern , and then we will match the new fount suffic with text.And if no suffix is found we will go next (m+1)th place where m is length of array

TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT -> text
TCCTATTCTT->pattern

TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT
TCCTATTCTT

TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT ?PATTERN FOUND
TCCTATTCTT

C)->Table by KMP

T	C	C	T	A	T	T	C	T	T
0	0	0	1	0	1	1	2	1	1

I am not getting What FSM you mean.

I am giving you Transition table for finite state automata.If you need finite automata for the.You can use simply my table .for that purpose.

THIS IS YOUR TRANSITION TABLE FOR FSM State ACT 021 0 2 10

//If you have any doubt .Please feel free to ask.

Thanks,

Add a comment

Answer 2

Similar Homework Help Questions

Consider the problem of searching for genes in DNA sequences. A DNA sequence is represented by...

Consider the problem of searching for genes in DNA sequences. A DNA sequence is represented by a text on the alphabet A, C, G, T, and the gene or gene segment is the pattern. Pattern: TCCTATTCTT Text: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT Construct the table and a diagram of the FSM used by the KMP algorithm.
b) Design a presorting-based algorithm to find the smallest possible mean of k elements in an array of n elements. Algorithm SmallestKMean (AI1. .n], k) c)Consider the problem of searching for genes...

b) Design a presorting-based algorithm to find the smallest possible mean of k elements in an array of n elements. Algorithm SmallestKMean (AI1. .n], k) c)Consider the problem of searching for genes in DNA sequences using Boyer-Moore string matching algorithm. A DNA sequence is represented by a text on the alphabet (A, C, G, T), and the gene or gene segment is the pattern. Construct the bad-symbol shift table and good-suffix shift table for the following gene segment: TAATAA Apply...
Genes are unique segements of A, T, C, and G sequences in our DNA. Each piece...

Genes are unique segements of A, T, C, and G sequences in our DNA. Each piece of our DNA contains many genes. The 46 human chromosomes contain around 20,000 genes. Gene 2 DNA molecule Linus Pauling's research was centered on the the function of one particular gene, the HBB gene. His data indicated that the cell uses the information in the HBB gene as a "recipe" to construct hemoglobin. The hemoglobin recipe in normal individuals was accurate so their cells...

write a flowchart searching sequence protocol using a pair of DNA sequences of vioB gene isolated...

write a flowchart searching sequence protocol using a pair of DNA sequences of vioB gene isolated from chromobacterium violaceum based on i ) its translation and ii ) potential open reading frame, iii ) the family it belongs to, iv ) its function and v ) structural forms. ( 12 marks ) please show clear and complete answers tq
If the length of the array P is 4 and the length of the array T...

If the length of the array P is 4 and the length of the array T is 14, how many shifts of P need to be performed in the string searching algorithm? a. 9 b. 10 c. 11 d. 12 What is the best case for the naive string search algorithm? a. The first character of the pattern P isn't present in text T b. All characters in pattern P are different c. All characters in text T are different...
You decide to make a construct that places the DNA between the genes upstream to a...

You decide to make a construct that places the DNA between the genes upstream to a reporter gene (GFP) in place of Gene 1. The full-length construct has the correct expression pattern in antennal discs. You then create several constructs that delete sections of the upstream DNA and score them for expression. The seven constructs are shown below; the black bars indicate the region(s) deleted in each construct. The data table on the right shows the expression results for each...

Problem 2: Sequence similarity measure. Let 3 and y be two given DNA sequences, represented...

Problem 2: Sequence similarity measure. Let 3 and y be two given DNA sequences, represented as strings with characters in the set {A, G, C,T}. The similarity measure of r and y is defined as the maximum score of any alignment of r and y, where the score for an alignment is computed by adding substitution score and deletion and insertion scores, as explained below. (Some operations have negative scores.) The score for changing a character T, into a...

Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a...

Homework Answers

Add Answer to:
Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a...

Post as a guest

Earn Coins