Question

e stwc snct 2pts. Caci 1. In order to elute Con A from the affinity beads, (a) 1.0M NaCI was used, (b) HRP was used, (c) the

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. In order to elute Con A from the affinity beads using elution buffer contained a carbohydrate binding protein. Hence, option e is correct.

2. A specific biological property is used to separate macromolecules in affinity chromatigraphy. Hence, option a is correct.

3. In order to separate lectins from protein, sephadex G 100 is used. Hence, option c is correct .

4. The effluent contain proteins that do no bind to sephadex 100 . Hence, option a is correct.

Add a comment
Know the answer?
Add Answer to:
e stwc snct 2pts. Caci 1. In order to elute Con A from the affinity beads,...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are to purify a highly soluble homotetrameric protein containing a NADP binding site, in its...

    You are to purify a highly soluble homotetrameric protein containing a NADP binding site, in its functional form, and a pI = 9 with a subunit molecular weight of 35,000 Da from a crude extract of E. coli. For this protein, select the four best techniques from the list below and place them in the correct order for the most reasonable strategy to obtain homogeneous protein. (A) Precipitation of proteins using high ionic strength (40%) ammonium sulfate, followed by a...

  • 14. Recombinant MBP-, GST- or GFP- fusion proteins are expressed in bacteria not only for affinity...

    14. Recombinant MBP-, GST- or GFP- fusion proteins are expressed in bacteria not only for affinity chromatography but also to ___________. A. overexpress the proteins in bacteria B. to reduce toxicity of the foreign proteins        C. for proper folding and keeping the proteins soluble D. to trace the cytological location of the foreign proteins                     15. You have constructed an insulin-GST fusion protein and expressed it in E. coli. You want to separate the recombinant...

  • Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from...

    Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from the lacZ gene we discussed in class. She put this expression plasmid into a bacterium. The promoter from the lacZ gene is diagrammed to the right.? 2) Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from the lacZ gene we discussed in class. She put this expression plasmid into a bacterium. The promoter from the lacZ gene...

  • Q2 An E. coli culture growing on a lactose supplemented media does not produce any β-galactosidase....

    Q2 An E. coli culture growing on a lactose supplemented media does not produce any β-galactosidase. Identify the incorrect statement. a. The E. coli could be a lacZ mutant b. The E. coli may have a mutated LacI protein that cannot bind to the operator c. The E. coli may have a mutated LacI protein that cannot bind to the inducer d. The growth medium may have a high amount of glucose e. The E. coli may have a mutated...

  • 1) Select all that apply. Globular proteins: a)are found in hair and wool. b)include myoglobin and...

    1) Select all that apply. Globular proteins: a)are found in hair and wool. b)include myoglobin and collagen. c)are usually water soluble. d)aggregate in aqueous media. e)are often made of β-pleated sheet and α-helix sections wrapped into compact structures. 2) Select all that apply. The Bohr effect: a)depends on the atomic orbital structure of hydrogen. b)can be summarized as a reduction in the oxygen affinity of hemoglobin with decreasing pH. c)is explained by the protonation of key amino acids, including the...

  • 1. trans-acting factors are able to regulate target genes from any chromosome, whereas cis-acting elements can...

    1. trans-acting factors are able to regulate target genes from any chromosome, whereas cis-acting elements can only regulate genes located in the same chromosome. a. True only in operons. In Eukaryotic systems, trans-acting factors only regulate genes in the same chromosome. b. True only in Eukaryotes. Prokaryotes don’t have cis-acting elements. c. True for any organism. d. False. The statement is erroneous 2. Unlike activators, repressors never affect chromatin structure. Repressors inhibit transcription only by binding to the binding sites...

  • biochemistry if you could please help me answer the following questions! EFT i 11) (6 pts)...

    biochemistry if you could please help me answer the following questions! EFT i 11) (6 pts) Which types of symmetry are possible for a protein with six (6) identical subunits? (Select all correct answers) a) cyclic C b) cyclic C3 c) dihedral D2 d) dihedral D e) octahedral o f) icosahedral ро, Yo₂ - pO₂+ Pso 12) (6 pts) What is the fractional saturation of oxygen binding to myoglobin when the partial pressure of oxygen is 1.5 torr and dissociation...

  • answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of...

    answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...

  • 5. Here is another promoter region in E. coli. (Also in a larger format in the...

    5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...

  • Matching Questions. Choose the correct answer from the list below (Not all of the answers will...

    Matching Questions. Choose the correct answer from the list below (Not all of the answers will be used). A) proteoglycans B) epimers C) axial D) glycogen E) cellulose F) Fehling's G) glycosyltransferases H) mucoproteins 1) enantiomers J) monosaccharides K) UDP L) lectins These monosaccharides differ at a single asymmetric carbon. Section: 11.1 These are stereoisomers that are mirror images of each other. Section: 11.1 _This class of compounds has the molecular formula of (CHO)n. Section: 11.1 This is a test...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT