Question

Question 31 A rare X linked disease runs on both sides of the families from a prospective couple. Susanas brother as well as

Question 42 The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. Answer

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans 31) 1/4

Ans: 1) XX X Susana XY Joe X X x XX Ncomal Xor CN) X Y N ribos ... Probability of diseased offspring feping = 1 /

Ans.2)a. The peptide sequence would be the same

Normal sequence-AAT will be trnscribed in UUA in mRNA which will translate into leucine.

If A is replaced by G I.e., GAT so after transcription CUA which will translate into leucine.

So sequence of peptide would be same.

Add a comment
Know the answer?
Add Answer to:
Question 31 A rare X linked disease runs on both sides of the families from a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A rare X linked disease runs on both sides of the families from a prospective couple....

    A rare X linked disease runs on both sides of the families from a prospective couple. Susana's brother as well as Joe's father have the condition. What is the probability that Susana and Joe's first child has the disease? Select one: a. 2/18 b. 1/4 c. 2/3 O d. 1/8 e. 1/16

  • A rare X linked disease runs on both sides of the families from a prospective couple....

    A rare X linked disease runs on both sides of the families from a prospective couple. Susana's brother as well as Joe's father have the condition. What is the probability that Susana and Joe's first child has the disease? Select one: a. 1/8 b. 2/3 c. 1/4 d. 1/16 e. 2/18

  • The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...

    The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5- TTATTCTTTAAT CAT-3 What would be the consequences of the highlighted A to be mutated to a G? Select one: a. The resulting peptide will likely be larger than the non-mutant peptide b. the primary sequence of the peptide will be different on one amino acid O C. The peptide sequence would be the same d. all the amino acids after...

  • The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...

    The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5'- TTATTCTTTAAT CAT-3' What would be the consequences of the highlighted A to be mutated to a G? Select one: a. the primary sequence of the peptide will be different on one amino acid b. all the amino acids after the mutation will be different than the non-mutant peptide c. The peptide sequence would be the same d. The resulting peptide...

  • Question 30 Not yet answered What would be the minimum codon size possible for a hypothetical...

    Question 30 Not yet answered What would be the minimum codon size possible for a hypothetical organism with 5 different nucleotides in their nucleic acids and 30 amino acids in their proteins? Points out of 2.50 P Flag question Select one: a. a different number of nucleotides per codon than the ones listed here b. 5 nucleotides per codon O c. 4 nucleotides per codon O d. 2 nucleotides per codon O e. 3 nucleotides per codon Question 31 Not...

  • Question 36 Not yet answered From the following list, select the statement that is incorrect for...

    Question 36 Not yet answered From the following list, select the statement that is incorrect for the corresponding organelle Points out of 2.50 P Flag question Select one: a. All statements regarding their corresponding organelles are true b. Chloroplast - Organelle thought to be the result of a endosymbiosis event where CO2 is reduced to carbohydrates O c. Mitochondria - double membrane organelle where, in the presence of oxygen, most chemical energy is generated d. Peroxisomes - single membrane organelle...

  • Question 16: The following shows the same segment of DNA that was shown above in Question...

    Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...

  • Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA...

    Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....

  • xProteins Quiz x ipids Quiz x Lipids Quiz t/view do?attempt- 1&context 0a4ce60a0a0001dc4786cd79dbacf795 Question1 Select one answer...

    xProteins Quiz x ipids Quiz x Lipids Quiz t/view do?attempt- 1&context 0a4ce60a0a0001dc4786cd79dbacf795 Question1 Select one answer Where do peptide bonds form? A. Between adjacent carboxyl groups on amino acids. B. Between amino acids of two different protein chains. C. Between the carboxyl group of one amino acid and the amino group of another amino o points acid. D. Between adjacent amino groups on amino acids. Question2 Select one answer The following structure is the amino acid glutamic acid. Four atoms...

  • Regarding transposable elements: Question 8 Not yet answered Points out of 2.00 P Flag question Select...

    Regarding transposable elements: Question 8 Not yet answered Points out of 2.00 P Flag question Select one: a. non autonomous elements require other elements for transposition b. autonomous elements encode the function needed for movement O c. mobile genetic elements are thought to be present in all forms of life d. transposable elements are common in most genomes e. all of these answers are correct o In prokaryotic cells: Question 9 Not yet answered Points out of 2.00 P Flag...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT