Question

Question 15 2 pts Given the DNA sequence 3 GTACG5 what is the sequence of the complementary strand? Include the directionali
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer: 5'CATGC3'

EXPLANATION:

DNA has two strands that are antiparallele to each other, so that the following complementary strand is present for the given DNA sequence.

Given DNA sequence: 3'GTACG5'

Complementary sequence: 5'CATGC3'

Add a comment
Know the answer?
Add Answer to:
Question 15 2 pts Given the DNA sequence 3 GTACG5' what is the sequence of the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...

    If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...

  • You are given the following sequence of DNA which encodes for a short protein (this is...

    You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...

  • Develop 3 individual DNA strands that includes all 4 bases and are each 40 bases long....

    Develop 3 individual DNA strands that includes all 4 bases and are each 40 bases long. (include directionality for each strand) TT I Arial 3(1201·T·EE: 5.00 From the 3 strands that you just developed, determine the consensus sequence. (include directionality) TT T Arial 3(12pt) T. - E . ES Determine the complementary strand to your consensus sequence with correct base pairing and include directionality for each strand Highlight the strand that would be your template for transcription TTT Arial 3(12pt)...

  • What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in...

    What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in the 3' to 5' direction.

  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • 2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...

    2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...

  • The sequence below is found in a DNA double helix. Fill in the complementary strand and...

    The sequence below is found in a DNA double helix. Fill in the complementary strand and include which ends are 5' and which ends are 3'. 5°- TTGACGGTTAA-3 3 - AACT GCC AATT-5 B) In the strand that you filled in above, circle the nucleotide(s) that has/have a free phosphate group

  • Question 14 4 pts Which one of the following enzymes WILL NOT participate in DNA replication?...

    Question 14 4 pts Which one of the following enzymes WILL NOT participate in DNA replication? O RNA ploymerase O DNA polymerase Ligase O Helicase Question 15 4 pts In DNA replication - if one DNA strand has nucleotide sequence as 5'ATGCITCCT3, The other strand of the DNA will have nucleotide sequence as and it will be synthesized in direction. OUACGAAGGA; 3' to 5' direction OTACGAAGGA; 3' to 5' direction OTACGAAGGA; 5' to 3' direction OTUCGUUGGU; 5' to 3' direction

  • If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence...

    If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence of the complementary stand?

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT