Question

Question 1 Not yet answered Consider the following western blot for tubulin. Each lane represents a different cell line cultu

Question 2 Which of the following elements are provided by the sperm during fertilization? Not yet answered Points out of 2.5

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. Answer: Option C is correct
Explanation:
The Western blotting utilizes a specific antibody to detect the expression of proteins.
In the given case, the beta-tubulin expression is checked by using a specific antibody.
All samples exhibited the band at the same location
= All tissues express beta-tubulin and the size is similar

2. Answer: Option D is correct
Explanation:
Fertilization involves the fusion of an egg cell with the sperm.
The egg cell provides the cytoplasm and DNA.
The sperm cell provides only DNA.

Add a comment
Know the answer?
Add Answer to:
Question 1 Not yet answered Consider the following western blot for tubulin. Each lane represents a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Consider the following western blot for tubulin. Each lane represents a different cell line culture. What...

    Consider the following western blot for tubulin. Each lane represents a different cell line culture. What can be concluded from this blot? 191 97 64- 51 -B-Tubulin 39 28 19 Select one: a. 8 different primary antibodies must have been used to produce this blot b. More than one statement can be concluded from this western blot c. The primary antibody used identified different epitopes present in each type of tubulin d. Tubulin is expressed in all cell lines tested...

  • Consider the following western blot for tubulin. Each lane represents a different cell line culture. What...

    Consider the following western blot for tubulin. Each lane represents a different cell line culture. What can be concluded from this blot? HepG2 Hela SVT2 A549 COS7 Jurkat MDCK PC12 MCF7 191 97- 64- 51 -B-Tubulin 39 28 19 Select one: a. 8 different primary antibodies must have been used to produce this blot b. Tubulins from different organisms vary in size c. The primary antibody used identified different epitopes present in each type of tubulin d. More than one...

  • A human cell has an abnormal sex chromosome constitution of XXY. Where could the non-disjunction event...

    A human cell has an abnormal sex chromosome constitution of XXY. Where could the non-disjunction event have occurred? Select one: a. Meiosis I of the father b. Meiosis Il of the mother c. Meiosis I of the mother d. Meiosis Il of the father e. More than one of these choices could result in an XXY cell Consider the following western blot for tubulin. Each lane represents a different cell line culture. What can be concluded from this blot? HepG2...

  • Question 19 Not yet answered The following diagram represents a replication bubble. The grey circles represents...

    Question 19 Not yet answered The following diagram represents a replication bubble. The grey circles represents 4 molecules of DNA polymerase III siting on a template strand and ready to add new nucleotides to the RNA primers (not shown). Which of the 4 DNA pol III molecules will create okazaki fragments? Points out of 2.50 P Flag question A B 5' 3' Select one: o a. Cand D O b. Only A O c. B and C O d. A...

  • Question 36 Not yet answered From the following list, select the statement that is incorrect for...

    Question 36 Not yet answered From the following list, select the statement that is incorrect for the corresponding organelle Points out of 2.50 P Flag question Select one: a. All statements regarding their corresponding organelles are true b. Chloroplast - Organelle thought to be the result of a endosymbiosis event where CO2 is reduced to carbohydrates O c. Mitochondria - double membrane organelle where, in the presence of oxygen, most chemical energy is generated d. Peroxisomes - single membrane organelle...

  • Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA...

    Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....

  • Question 12 Not yet answered Points out of 1.00 P Flag question The DNA remains in...

    Question 12 Not yet answered Points out of 1.00 P Flag question The DNA remains in the nucleus when RNA is made. That process is properly known as Select one: O a. transcription. O b. translation. c. transmutation. d. conversation. Question 13 Not yet answered Points out of 1.00 P Flag question The copy of the DNA in the form of RNA leaves the nucleus and goes to the Select one: a. cell membrane. b. Golgi bodies C. vacuole. Od....

  • Question 38 Which of the following statements regarding CRISPR-Cas system is TRUE? Not yet answered Points...

    Question 38 Which of the following statements regarding CRISPR-Cas system is TRUE? Not yet answered Points out of 2.50 Select one: a. CRISPR-Cas system uses a DNA-directed nuclease to degrade viral RNA P Flag question O b. CRISPR-Cas system uses an RNA-directed nuclease to degrade viral DNA C. CRISPR-Cas system uses a RNA-directed nuclease to degrade viral RNA O d. CRISPR-Cas system uses a DNA-directed nuclease to degrade viral DNA e. CRISPR-Cas is a defense mechanism in eukaryotes against viral...

  • Question 43 Not yet answered The sequence below is the anticodon of a tRNA molecule. What...

    Question 43 Not yet answered The sequence below is the anticodon of a tRNA molecule. What amino acid do you expect to find bound to the tRNA? Use the 3 letter code for the aminoacid name (i.e gly for glycine), case is not important. 5-tcg-3 Points out of 2.50 P Flag question Answer: Question 44 Not yet answered Points out of 2.50 If a base is misread, and in consequence, the wrong nucleotide is written in the nascent DNA strand,...

  • Question 59 Not yet answered Which of the listed characteristics is a key difference between prokaryotes...

    Question 59 Not yet answered Which of the listed characteristics is a key difference between prokaryotes and eukaryotes? Points out of 2.50 p Flag question Select one: O a. all of the listed characteristics are shared between prokaryotes and eukaryotes O b. Eukaryotes, but not prokaryotes, undergo DNA replication before cell division O O c. Eukaryotes, but not prokaryotes, perform cell respiration to produce ATP through oxidative phosphorylation d. Prokaryotes, but not eukaryotes, are capable of forming a protective cell...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT