Question

The Ught Went Out on Sunshine In the quiet town of Utopla, 90 year-old Sunshine Moon had been murdered. Her murder had not only been brutal (her heart had been cut out), but also creepy. It appeared as if Sunshine's blood had been collected in a small sauce pan and tasted. The murder showed other signs of the occult: a candlestick and a pair of crossed pokers had been arranged near the body. Further investigation Indicated this was no supernatural villain at work. The murderer had worn tennis shoes which left distinctive footprints under the glass door which had been shattered by a plece of garden slate. Moreover, the window sill had blood stalns on it. The police hoped this would help them solve the case. Question 1: Before DNA technology, how would forensic scientists use blood to help narrow down their suspects? These days we can use DNA to help determine relationships such as paternity or criminal activity. A common way is to look for differences in DNA, either in base sequence of nucleotides or in length (added or deleted bases). As an example, consider the Amelogeningene, which is involved in the formation of tooth enamel. The gene is found on both the X and the Y chromosomes, but the X copy is different (has missing bases) from the Y copy. The following illustrates this using a segment of the Amelogenin gene. The bases missing from the X copy are underlined on the Y copy so that you can easily tell which ones they are. Amelogenin Gene I Y: S'CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTC 3 X: 5 CCCTGGGCTCTGGTGTGTTGATTC 3 Question 2: Write the nucleotide base sequence of the DNA strand that would be complementary to the one shown for the Y chromosome. How would the two strands be joined together? It is possible to extract the DNA from a cell and make many copies of it by the technique Of PCR. These copies can then be examined by electrophoresis, where they will be separated by size. Question 3. From the crime scene at Sunshine's house, multiple blood samples were obtained. Since DNA has to come from cells, but human red blood cells circulating in the bloodstream lack a nucleus, where did the DNA come from? (You may need to research this.) Examine the following which shows the samples separated by size. The numbers correspond to size. The brown curves are standards (controls) run to make sure everything is working correctly. The green curves are the sample curves and are the ones you need to interpret Question 4: The blood left at the crime scene at Sunshine's house was from a male. Which of the following DNA profiles (A or B] could have come from the suspect? Explain in detail why you chose the sample you did

Answer 1

1.Before the advancement in DNA technology, most crime labs relied upon the ABO blood grouping system to characterize bloodstains. This indicates that the blood could have come from 4 to 49% of the population.Most crime labs are relying on DNA analysis to charcterise bloodstains, so blood source can now be statistically narrowed down to one person out of several million or even several billion.

2. 3" GGGACCCGAGACATTTCTTATCACACAACTAAG 5"

3. Blood is an excellent source of human DNA.DNA is obtained from the white blood cells of the human blood but not from the red blood cells which lacks nuclei, (as nuclei is the repository of the genetic material i.eDNA)

4. It is possible to find out the gender of a person from the blood sample. Humans generally contains 22autosomes and 1 pair of sex chromosomes, females have a pair of X-chromosomes while males have an X-chromosome and a Y-chromosome. Therefore, the presence or the absence of Y-chromosome can determine the gender of a person from a unknown sample