Question
alllll them please all
To MOST readily demonstrate transformation of bacteria in the laboratory one could extract DNA from: A) his cells and add the
Imagine the gene encoding the lac repressor was mutated so that lactose (more technically allolactose) no longer bound to the
Phosphate groups can be added to or removed from histones. Phosphates have an overall negative charge. You would expect the a
If you had a short, linear segment of double stranded DNA with the following sequence: 5 AATGCGTGCTGATGCAAGCTTGCTGATGCGAATTC
Question 37 (1 point) If you had a short, linear segment of double stranded DNA with the following sequence: 5 AATGCGTGCTGAT
Suυυιιυιιυν ( γυπτι) Which list of ingredients is the most complete and correct for a sequencing reaction? A) DNA polymerase,
If the lac operon operator sequence was mutated so that it no longer bound the lac repressor, which of the following would pr
Base excision repair allows for the: A) removal of a stretch of DNA that a mutant sequence, based upon the methylation state
Which two primer pairs would work to PCR amplity the double stranded DNA target sequence shown below? 3...GGCTGAGTGCTGGATGAGT
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question 1: Answer is option B.

His+ cells have the synthetic gene of Histidine. Thus, additional of His+ cell DNA to his- cells will generate recombinant his- cells having histidine synthetic gene. Thus, these cells are able to grow in Histidine without medium.

Question 2: Answer is option C.

Due to binding of allolactose to the repressor monomers, repressor proteins can't form the tetrameric structure. But if allolactose can't able to bind the repressor then tetrameric structure will form and repressor protein remains bound to the operator region even in absence and presence of allolactose.

Question 3: Answer is option B.

DNA is negatively charged and histone proteins are mostly positively charged. Thus, DNA-histone interaction occurs. If histone's positive charge is shielded by phosphate then the interaction between DNA and histone will not occur due to repulsion of negative charges.

Question 4: Answer is option D.

Both EcoRI and HindIII will cut the DNA once generating two fragments each.

Question 5: Answer is option B.

By Sanger's method DNA sequencing is possible.

Question 6: Answer is option D.

Expression of lac operon genes don't occur if glucose is present in the medium. At that time lac repressor inhibits the expression of lac operon genes. But due to mutation of operator region this inhibition is inhibited. So, lac operon genes will also express even in presence and/or absence of glucose and lactose.

Question 7: Answer is option B.

BER occurs if there is any apurinic site present.

Question 8: Answer is option C

Add a comment
Know the answer?
Add Answer to:
alllll them please all To MOST readily demonstrate transformation of bacteria in the laboratory one could...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • all them please Question 23 (1 point) The A and B alleles in ABO blood types...

    all them please Question 23 (1 point) The A and B alleles in ABO blood types can give rise to an individual that is blog type AB. This specific blood type is an example of: A) multiple alleles B) epistasis C) codominance D) partial dominance Imagine the gene encoding the lac repressor was mutated so that lactose (more technically allolactose) no longer bound to the repressor. However, the lac repressor was still capable of binding DNA at the operator sequence....

  • The lac operon contains a DNA sequence known as the lac promoter (P or P+ for...

    The lac operon contains a DNA sequence known as the lac promoter (P or P+ for wild type; P– for mutant (RNA polymerase does not bind)) that serves as the RNA polymerase binding site. The lac operon also contains a DNA sequence known as the Lac operator (O or O+ for wild type; O– or Oc for mutant (lac repressor cannot bind)) which is the binding site for lac repressor. The lac repressor, a protein, is encoded by the lac...

  • for 1-5 define those The Lac operon is an inducible set of genes found in bacteria...

    for 1-5 define those The Lac operon is an inducible set of genes found in bacteria cells that helps the bacteria to metabolize the disaccharide lactose. When it is turned on it produces proteins that pump lactose into the bacteria cell and break it down into glucose and galactose, which can then be used by the bacteria as a source of energy The two figures below show the Lac Operon along with the lacl gene (which regulates the Lac operon...

  • help please as soon as possible A mutant E. coli strain is found that does not...

    help please as soon as possible A mutant E. coli strain is found that does not synthesize any enzymes in the presence or absence of lactose (or allolactose). W mutation(s) can lead to this outcome? The lac operon is shown here as a guide. fones where proteins bind DNA genes and regulatory sequences Operator La repressor B-galactosidase B-galactos de transactylase proteins promoter Operator Lacy Lac A laci o Lacz

  • 5. Jacob, Monod, and Pardee used various E.coli mutants to help determine how the lac operon...

    5. Jacob, Monod, and Pardee used various E.coli mutants to help determine how the lac operon is regulated. The descriptions of some of the mutants are listed. For each E. coli mutant determine if the lac operon would be on or off in a lactose-only environment. laci mutant: This mutant produces a super repressor that is not inactivated by allolactose. It will still stick. Operater will be off, lacO mutant: This mutant has an altered operator sequence so that the...

  • QUESTION 8 The following situations (1-4) involve different types of gene regulation in prokaryotic cells as shown. OFF...

    QUESTION 8 The following situations (1-4) involve different types of gene regulation in prokaryotic cells as shown. OFF and ON reter to whether the gene is transcribed or not. Draw clearly-labelled regulatory proteins and effector molecules in each diagram to explain how the regulation works in each case. The first one has been done for you as an example a) (6 marks) Type of Regulation Regulatory protein effector molecule 1 DNA X negative inducible OFF ON 2 negative repressible DNA...

  • A mutant E. coli strain is found that synthesizes B-galactosidase and permease but no B-galactoside-transacetylase in...

    A mutant E. coli strain is found that synthesizes B-galactosidase and permease but no B-galactoside-transacetylase in the presence of lactose (or allolactose). What mutation(s) can lead to this outcome? The lac operon is shown here as a guide. zones where proteins bind DNA: genes and regulatory sequences I lacl promoter operator lac Z l ac Y La repressor B-galactosidase B-galactoside transacetylase proteins Operator Laci promoter Lac Y Lac A Lacz

  • 20862a a A mutant E. coli strain is found that does not synthesize any enzymes in...

    20862a a A mutant E. coli strain is found that does not synthesize any enzymes in the presence or absence of lactose for allolactose). What mutation(s) can lead to this outcome? The lac operon is shown here as a guide. ones where proteins bind DNA genes and regulatory sequences och Operator o Lacy o Lacz o Laca promoter MacBook Air * जीप

  • 3. Mutations in bacteria that affect gene regulation may have a cis- or trans-effect on the...

    3. Mutations in bacteria that affect gene regulation may have a cis- or trans-effect on the expression of the protein-encoding genes in an operon? How would the following mutations affect the expression of the lac operon? Assume there could be more than one lac operon in the cell and that no glucose is present.   A. A mutation in the operator site that prevents the lac repressor from binding.   B. A mutation in the lacI gene that prevents allolactose from binding,...

  • A) An Operon is:? 1- A gene that affect another gene transcription. 2. A gene coding...

    A) An Operon is:? 1- A gene that affect another gene transcription. 2. A gene coding for a metabolic pathway. 3. A protein that blockgene expression. 4. A set of genes under the control of one promoter. B )- In bacteria the Lac Operon genes code for proteins that break down.? 1- Arabinose 2- Lactose 3- Galactose 4- Glucose C )mRNA processing involves removal of .......? 1- Introns 2- The poly-A tail 3- The 5' cap 4- Exons D )...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT