The correct answer is first (Frameshift mutation).
Frameshift mutation results from addition or deletion of one or two nucleotides in DNA which change the reading frame (triplet codon) and a different aminoacid is coded.
In the present question, extra C (Cytosine) was added in the third triplet changing the original DNA sequence of CTT in to CCT (as extra C has been added between C and T). This has resulted in "frame shift"
Original DNA sequence: AAA ATG CTT CCT
Addition of extra C resulted in DNA sequence to be: AAA ATG CCT TCC T
Hence, frame shift mutation changed the codon from Glu-Glu to Gly-Arg.
Option second is incorrect: As option first is correct, this statement is wrong.
Option third is incorrect: it is very much visible in the image that two amino acids have been altered. Hence, this option is incorrect.
Option fourth is incorrect: Non-sense mutation results in the change of codon in to stop codon thereby causing immature completion of translation. Hence, this option is not correct.
Option fifth is incorrect: Missense mutation result in change of one codon hence, only one amino acid get altered. However here two amino acids were altered. Hence, this option is not correct.
Option sixth, seventh and eighth are incorrect: the mutation occurred does not belong to non sense or missense mutation. Hence, these options are incorrect.
Option ninth is incorrect: Silent mutation does not cause change in amino acid sequence. Hence, this option is also incorrect.
Question 38 1 pts Chapter 17: Study the "normal" DNA and then compare to the DNA...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
1. Using the following DNA segment, the RNA transcribed and the translation DNA 5’ ATG CCG GGT ACA TTC GGC CCA TAC 3’ DNA 3’ TAC GGC CCA TGT AAG CCG GGT ATG 5’ RNA 5’ AUG CCG GGU ACA UUC GGC CCA UAC 3’ Protein met pro gly thr phe gly pro. tyr DRAW an example of each of the following (circle the mutation that has occurred): A silent mutation A frameshift mutation A nonsense mutation A missense mutation
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
all of them please
Question 12 (1 point) Which of the following conditions would kill amp' lac his bacteria? amp = ampicillin (an antibiotic), lac = lactose (a carbohydrate), his = histidine (an amino acid) A) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, and contained the amino acid histidine. B) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, but did not contain the...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....