Homework Answers
Solution:
A form of DNA is a right-handed double helix. It is rarely present in normal physiological condition. The molecule is asymmetrical and one turn of the helix consists of 11 base pairs with a length of 2.86nm.
While, Z-form DNA is a left-handed double helix. It has a zigzag appearance of backbone which allows it to be distinguished from other forms of DNA. One turn of Z-DNA has 12 base pairs and the length is 4.56nm.
So, the most noticeable difference is A form of DNA is Right handed double helix and is asymmetrical. While, Z form of DNA is Left handed double helix and has Zig Zag appearance of backbone.
Add Answer to:
0 words Question 28 5 pts (Short answer) In one sentence, identify the most noticeable difference...
please answer both questions Question 10 Explain how a server using a single UDP socket can...
please answer both questions
Question 10 Explain how a server using a single UDP socket can differentiate between its clients? B IV AA- IEE..X XEE 2.2 VX - 1 12pt Paragraph O words Question 17 4 pts A socket on a host occupies how many IP addresses and port numbers? Β Ι Ο Α' A. IE3 3.x x, ! E - XT 12pt Paragraph
Question 46 4 pts What is the difference between net working capital and cash? Will net...
Question 46 4 pts What is the difference between net working capital and cash? Will net capital always increase when cash increases? B IV AA- IEE 111 **, SE 2 x 12pt Paragraph O words MacBook Pro
Question 3 1 pts What is the difference between traveler's diarrhea and staphylococcal food poisoning? Other...
Question 3 1 pts What is the difference between traveler's diarrhea and staphylococcal food poisoning? Other than that they are caused by different organisms. How could you tell the difference between the two? HTML Editora B I U A А Ix Ex x vx - 12pt Paragraph O words
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A)...
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31
10 pts Write a balanced chemical equation for the following reaction in an acidic solution. Clo(aq)...
10 pts Write a balanced chemical equation for the following reaction in an acidic solution. Clo(aq) + Cr(OH)3(s) C1-1 + Cro 2-aq) Please show all steps. If all steps are not provided, you will get 10% only. HTML Editor BIV AA- IE *: 11 x Do ? N V @ @ 14 12pt Paragraph I O words
P O words D Question 6 1 pts Convert (626), to octal D Question 7 1...
P O words D Question 6 1 pts Convert (626), to octal D Question 7 1 pts What is the difference between a class and an object? Provide one example of a class and an object. You do not need to use pseudocode. HTML Editor B IVAA TE VE TT- 12pt Paragraph
O words Question 3 12.5 pts You have $7,800 to invest in an account that will...
O words Question 3 12.5 pts You have $7,800 to invest in an account that will pay you 15% compound interest per year. How much more money will you have after seven years if the interest is compounded monthly instead of annually? HTML Editor B IV A - A - IE * 3 1 1 x *, EE - D el vo o o 1 12pt - P.
c++ (explain Question 26 3 pts For the next three questions, consider the following BST: 21...
c++
(explain
Question 26 3 pts For the next three questions, consider the following BST: 21 27 We insert node 20. Where does it go? (answer by stating, for example, "the new node goes to the left of nodex") HTML Editor B I U - IE * 3 1 XX, DE E TTTT 12pt Paragraph Question 27 3 pts Now we delete node 34. After the delete, what node is to the right of node 29? HTML Editor В І...
Question 3 1 pts What is the difference between traveler's diarrhea and staphylococcal food poisoning? Other...
Question 3 1 pts What is the difference between traveler's diarrhea and staphylococcal food poisoning? Other than that they are caused by different organisms. How could you tell the difference between the two? HTML Editora B 7 U A А I 를 를 들 Ex? ✓x T 12pt Paragraph 0 words
Question 22 14 pts One of the most visible examples of X-inactivation is a calico cat,...
Question 22 14 pts One of the most visible examples of X-inactivation is a calico cat, which has the genotype Xºxb. A calico mother and an orange father have a litter of kittens, and to everyone's surprise, one of the kittens appears to be male but has a calico pattern. Explain how this might happen and what specific genotype is most likely responsible. (if you want to use superscript in your notation like I did, it's the little "T" button...
please answer both questions
Question 10 Explain how a server using a single UDP socket can differentiate between its clients? B IV AA- IEE..X XEE 2.2 VX - 1 12pt Paragraph O words Question 17 4 pts A socket on a host occupies how many IP addresses and port numbers? Β Ι Ο Α' A. IE3 3.x x, ! E - XT 12pt Paragraph
Question 46 4 pts What is the difference between net working capital and cash? Will net capital always increase when cash increases? B IV AA- IEE 111 **, SE 2 x 12pt Paragraph O words MacBook Pro
Question 3 1 pts What is the difference between traveler's diarrhea and staphylococcal food poisoning? Other than that they are caused by different organisms. How could you tell the difference between the two? HTML Editora B I U A А Ix Ex x vx - 12pt Paragraph O words
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31
10 pts Write a balanced chemical equation for the following reaction in an acidic solution. Clo(aq) + Cr(OH)3(s) C1-1 + Cro 2-aq) Please show all steps. If all steps are not provided, you will get 10% only. HTML Editor BIV AA- IE *: 11 x Do ? N V @ @ 14 12pt Paragraph I O words
P O words D Question 6 1 pts Convert (626), to octal D Question 7 1 pts What is the difference between a class and an object? Provide one example of a class and an object. You do not need to use pseudocode. HTML Editor B IVAA TE VE TT- 12pt Paragraph
O words Question 3 12.5 pts You have $7,800 to invest in an account that will pay you 15% compound interest per year. How much more money will you have after seven years if the interest is compounded monthly instead of annually? HTML Editor B IV A - A - IE * 3 1 1 x *, EE - D el vo o o 1 12pt - P.
c++
(explain
Question 26 3 pts For the next three questions, consider the following BST: 21 27 We insert node 20. Where does it go? (answer by stating, for example, "the new node goes to the left of nodex") HTML Editor B I U - IE * 3 1 XX, DE E TTTT 12pt Paragraph Question 27 3 pts Now we delete node 34. After the delete, what node is to the right of node 29? HTML Editor В І...
Question 3 1 pts What is the difference between traveler's diarrhea and staphylococcal food poisoning? Other than that they are caused by different organisms. How could you tell the difference between the two? HTML Editora B 7 U A А I 를 를 들 Ex? ✓x T 12pt Paragraph 0 words
Question 22 14 pts One of the most visible examples of X-inactivation is a calico cat, which has the genotype Xºxb. A calico mother and an orange father have a litter of kittens, and to everyone's surprise, one of the kittens appears to be male but has a calico pattern. Explain how this might happen and what specific genotype is most likely responsible. (if you want to use superscript in your notation like I did, it's the little "T" button...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago