Question

Using what youve learned about strings, variables, files, and dictionaries in Python, build a random plot/insult/anything ge

please post the screenshot of the output. I want to learn from it
0 0
Add a comment Improve this question Transcribed image text
Answer #1

random Package

The random package allows you to select or give as output any random element from an array or a python list.

It does not matter what data types are present in the list or array.

This method or package works very good for generating random numbers or strings.

choice() Method :

The choice() method returns a randomly selected element from the specified sequence.

The sequence can be a string, a range, a list, a tuple or any other kind of sequence.

=> So in this python script we are going to use our knowledge on the above topics to crate a random Movie Genre generator from a list named Movie Genre which contains a wide range of genres

Code ::

import random

MovieGenre = [ "Comedy", "Action", "Horror", "Animation", "Romance",
               "Romantic Comedy", "Thriller", "Drama" , "Adventure", "Musical", "Mystery",                         "Science Fiction", "Fantasy" ]
print('Are You bored Siting at home')
print('And cant decide what movie genre to watch?')
print("We Will help you out")
print("Movie Genre For you today is : ", random.choice(MovieGenre))

#run the script to know your movie genre

Screenshot of Code

import random MovieGenre = [. Comedy, Action, Horror, Animation, Romance, Romantic Comedy, Thirller, Drama A

Output of the python script ::

Are You bored Siting at home And cant decide what movie genre to watch? We Will help you out Movie Genre For you today is : A

Add a comment
Know the answer?
Add Answer to:
please post the screenshot of the output. I want to learn from it Using what you've...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • SCREENSHOTS ONLY PLEASE!!! DON'T POST ACTUAL CODE PLEASE LEAVE A SCREENSHOT ONLY! ACTUAL TEXT IS NOT NEEDED!!! myst...

    SCREENSHOTS ONLY PLEASE!!! DON'T POST ACTUAL CODE PLEASE LEAVE A SCREENSHOT ONLY! ACTUAL TEXT IS NOT NEEDED!!! mystring.h: //File: mystring1.h // ================ // Interface file for user-defined String class. #ifndef _MYSTRING_H #define _MYSTRING_H #include<iostream> #include <cstring> // for strlen(), etc. using namespace std; #define MAX_STR_LENGTH 200 class String { public: String(); String(const char s[]); // a conversion constructor void append(const String &str); // Relational operators bool operator ==(const String &str) const; bool operator !=(const String &str) const; bool operator >(const...

  • Please Complete the following C Code with Comments explaining your solution and post a screenshot of...

    Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...

  • In Java(using BlueJ) Purpose Purpose is to practice using file input and output, and array list of objects. Also, this lab specification tells you only what to do, you now have more responsibility to...

    In Java(using BlueJ) Purpose Purpose is to practice using file input and output, and array list of objects. Also, this lab specification tells you only what to do, you now have more responsibility to design how to do it. Problem description You are given a text file called 'Students.txt' that contains information on many students. Your program reads the file, creating many Student objects, all of which will be stored into an array list of Student objects, in the Students...

  • Lab 6 Instructions Objectives: • Executing and experimenting with programs that handle array related topics such...

    Lab 6 Instructions Objectives: • Executing and experimenting with programs that handle array related topics such as declaration, initialization, storing, retrieving, and processing elements. • Effectively manipulating and using ArrayList objects. • Becoming familiar with the use of arrays as method arguments and how array elements are passed to and returned from the called method. • Mastering the use of various debugging tools available on the Eclipse IDU. Important: EVERY one of the following Activities MUST be in a separate...

  • This C++ Program consists of: operator overloading, as well as experience with managing dynamic memory allocation...

    This C++ Program consists of: operator overloading, as well as experience with managing dynamic memory allocation inside a class. Task One common limitation of programming languages is that the built-in types are limited to smaller finite ranges of storage. For instance, the built-in int type in C++ is 4 bytes in most systems today, allowing for about 4 billion different numbers. The regular int splits this range between positive and negative numbers, but even an unsigned int (assuming 4 bytes)...

  • Please read the article and answer about questions. You and the Law Business and law are...

    Please read the article and answer about questions. You and the Law Business and law are inseparable. For B-Money, the two predictably merged when he was negotiat- ing a deal for his tracks. At other times, the merger is unpredictable, like when your business faces an unexpected auto accident, product recall, or government regulation change. In either type of situation, when business owners know the law, they can better protect themselves and sometimes even avoid the problems completely. This chapter...

  • Code is in C# Your instructor would like to thank to Marty Stepp and Hélène Martin...

    Code is in C# Your instructor would like to thank to Marty Stepp and Hélène Martin at the University of Washington, Seattle, who originally wrote this assignment (for their CSE 142, in Java) This program focuses on classes and objects. Turn in two files named Birthday.cs and Date.cs. You will also need the support file Date.dll; it is contained in the starter project for this assignment. The assignment has two parts: a client program that uses Date objects, and a...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT