Question

and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentratio
Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + den
Genomic analysis of a fish reveals that this species has dozens of functional copies of a gene that are nearly identical to o
Under which circumstances would metagenomic studies be more useful than traditional methods? O a. The organisms are easily cu
A promoter is an example of a(n) O a. rRNA gene. O b. regulatory sequence. O c. transposable element. O d. open reading frame
Refer to the table. The table shows prokaryote (bacterial species A, B, C, D, and along with the genes they contain (Note: x
Refer to the table showing chromosome sequences from different people. The rows represent the individuals, while the columns
What is the major difference between the DNA sequencing techniques developed by Sanger and others in the 1970s and high-throu
Which material would not be required for determining the sequence of a 400 bp DNA fragment by the high-throughput sequencing
A doctor acquires genomic information from her patient. After examining the patients sequence and inferring risk factors, sh
Which DNA sequence would be the most difficult to assemble? O a. A sequence consisting of several short repeated fragments O
In high-throughput DNA sequencing technology, the fluorescent dye a. produces many identical copies of specific DNA fragments
Suppose a drug for high blood pressure is inactive when it is ingested but is converted into an active form by an enzyme in t
Which statement about the globin genes in humans is false? O a. All are expressed at the same time. b. The genes are also fou
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer-1

In the 2-D gel electrophoresis the seperation of protiens and other biomolecules on the basis of their size and the charge b/c in this technique we use the electic charge to move the biomolecules on side of opposite charge.Havier move less towards the well(present in electrophresis mechine) but lighter molecule move far or reach more near to well from the point of origin.

So the D option is correct.

Answer-2

No gene in this given table of strain is core gene b/c core genes are those gene which are present in all the available strains. So their is no such gene which is present in all the strains.Only the A & B gene is present in mostly but absent in starin2 and strain1 respectively so these are not considered as core gene.

Hence the correct option is 1st.

Answer-3

The reason for this type of observarion is that DNA consist of heterochromatin(intrones) and euchromatin(exons) in which heterochromatin part forms major part of our DNA which are same in almost all species of an organism,which is genetically inactive.So the D option is correct well.

Answer-4

The first option is correct.By using these method we takle the problem of making of culture of that organism.

Add a comment
Know the answer?
Add Answer to:
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration;...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • estion 18 and Two-dimensional gel electrophoresis separates proteins based on a. size; shape b.shape; charge C....

    estion 18 and Two-dimensional gel electrophoresis separates proteins based on a. size; shape b.shape; charge C. size; concentration d. size; charge e concentration; shape Question 14 When eukaryotic genomes and prokaryotic genomes are compared, a. in eukaryotic genomes, there is a single origin of replication on each chromosome. b.eukaryotic genomes tend to have fewer regulatory sequences than prokaryotic genomes. c. the percentage of the genome devoted to coding sequences in eukaryotic genomes is lower than in prokaryotic genomes. d. eukaryotic...

  • A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...

    A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...

  • Proteomes are analyzed using: a) only DNA sequencing b) 2D gel electrophoresis c) Southern blots d)...

    Proteomes are analyzed using: a) only DNA sequencing b) 2D gel electrophoresis c) Southern blots d) ASO's Which of the following is true? a) Human genes are all unique and show no similarity to genes from other organisms. b) only 1% of human genes show a high degree of similarity to genes from other organisms. c) Many human genes show a high degree of similarity to genes from other organisms. Which of the following is true about open reading frames?...

  • The observation that in any DNA sample, A T and G C A. DNase sequencing An...

    The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...

  • Two identical twins who showed very similar methylation patterns when they were 4 years old show...

    Two identical twins who showed very similar methylation patterns when they were 4 years old show very divergent patterns at age 40. This divergence is most likely due to a different alternative splicing in the two individuals Ob different levels of histone acetyltransferase in the two individuals. Oc environmental differences that they experienced as adults. O d. different genomic imprinting in the two individuals. O e differences in their experiences in utero Suppose that a certain enzyme is synthesized whenever...

  • Question 7 estion 7 0.3125 points Suppose that in a Sanger sequencing reaction, sequences are readable...

    Question 7 estion 7 0.3125 points Suppose that in a Sanger sequencing reaction, sequences are readable for a few dozen nucleotides but then become increasingly difficult to road. It is determined that the chains are terminated to readily. What is the most likely cause? a. Too much of the dNTPs b. Insufficient fluorescent dye Too much fluorescent dye d. Incorrect primer e. Insufficient dNTPs Question of 20 Moving to another question will save this response Question 13 Which statement comparing...

  • strand(s) and the RNA molecule is made up of strand(s). The DNA molecule is made up...

    strand(s) and the RNA molecule is made up of strand(s). The DNA molecule is made up of O a. 4; 2 Ob. 1; 1 O c. 2; 1 O d. 1; 2 O e. 2; 4 QUESTION 45 The formation of large molecules from small subunits is known as what kind of reaction? O a reduction O b.condensation Oc decarboxylation d. hydrolysis O e. oxidation What is formed when an atom loses or gains an electron? O a. ion b....

  • 4. In a lake governed by the food web shown in the image to the right, 500 brown trout are added from fisheries. Which of the following outcomes would most likely be expected? A. Tadpole populat...

    4. In a lake governed by the food web shown in the image to the right, 500 brown trout are added from fisheries. Which of the following outcomes would most likely be expected? A. Tadpole population will increase B. Duck population will decrease C. Algae population will increase D. Lilly Pad population will decrease E. Caddis Fly larvae will increase 5. Which of the following pieces of evidence most strongly supports a common ancestor of all life on Earth? A....

  • 2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

    2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...

  • QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into...

    QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into a tool for biotechnology? a. It could possibly be turned into a viral vector against lung cancers b. Its promoters might be used to express genes in lung cells c. Its surface proteins could be used for new epitope tags d. All of the above QUESTION 2 Which of the following are applications of molecular assembly described in this course? a. It can be...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT