Homework Answers
The proteins synthesised in the rough ER moves move through the endomembrane system and are transported out from the trans face of the Golgi apparatus in vescicles known as transport vesicles.These transport vesciles move through the cytoplasm and then go on to fuse with the plasma membrane of the cells finally releasing the protein to the outside of the cell
Proteins secretory pathway follows the below order from first to last:
- from rough ER to
- ER then to
- Golgi transport vesicles then to
- Golgi cisternae then to
- secretory or transport vesicles then to
- cell surface via exoxytosis to outside.
Add Answer to:
4. (4 pts.) Describe in detail the movement of a protein from a ribosome through the...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
3. (4 points) Briefly describe the path a protein made by ribosomes that are attached to...
3. (4 points) Briefly describe the path a protein made by ribosomes that are attached to the endoplasmic reticulum will follow through the endomembrane system in order to be exported from the cell. Include in your answer which other organelles the protein will move through, how the protein is moved from one organelle to another, and the process that a cell would use to export the protein. 4. Fill in the diagram below with what you learned about the cell...
Insulin is a protein which is synthesized and secreted by pancreatic cells. Describe the path insulin...
Insulin is a protein which is synthesized and secreted by pancreatic cells. Describe the path insulin proteins would take through the cell from it's transcription in the nucleus to its secretion into the extracellular matrix. Describe the structure and function of all the organelles involved and describe what happens to insulin as it moves through endomembrane system. (10 marks)
Describe, with specific detail (step-by-step cause/effect) and drawings, how glucose is transported across the membrane via...
Describe, with specific detail (step-by-step cause/effect) and drawings, how glucose is transported across the membrane via Passive Transport. Include concentrations gradients, membrane proteins, direction of flow and any other details you feel are relevant Name two kinds of proteins that are involved in the movement of glucose into the cell.
Question 15 (2 points) ✓ Saved Select all of the following that are part of the...
Question 15 (2 points) ✓ Saved Select all of the following that are part of the extracellular matrix. Actin Fibronectin Myosin Collagen Question 16 (4 points) ✓ Saved Please put the following activities of translation initiation in order from first to last. 1 v Small subunit of ribosome binds to mRNA 4 v A-site is open 2 tRNA with anticodon UAC binds to mRNA codon AUG 3 large subunit of ribosome binds to mRNA Question 17 (2 points) ✓ Saved...
_____membranes proteins are associated with the bilayer through interactions with other membrane component on the surface...
_____membranes proteins are associated with the bilayer through interactions with other membrane component on the surface of the membrane. Net movement of particles from a region where they are more concentrated to a region where they are law concentrated is called Diffusion of water through a selectively permeable membrane down its own concentration gradient It called A solution with an equivalent concentration of water and hence the tame osmotic pressure as the fluid inside the cell is said to be...
Part A - The Vocabulary of Protein Protein is involved in a wide range of important...
Part A - The Vocabulary of Protein Protein is involved in a wide range of important body functions, so adequate intake of it is essential While low protein intake can cause malnutrition and certain health conditions, too much protein can cause health problems as well Match the words in the left column to the appropriate blanks in the sentences on the right. ► View Available Hint(s) Reset Help hormones 1. Proteins called aid the immune system in its fight against...
Scientists can track the movement of proteins through the endomembrane system using an approach known as...
Scientists can track the movement of proteins through the endomembrane system using an approach known as a pulse-chase experiment. This experiment involves the “pulse” phase: Cells are exposed to a high concentration of a radioactively labeled amino acids for a short period to “tag” proteins that are being synthesized. the “chase” phase: Any unincorporated (not used to make proteins) radioactively labeled amino acids are washed away and large amounts of the same, but unlabeled, amino acid are added. Only those...
. For each of the 3 situations below, use an arrow to indicate the net movement...
. For each of the 3 situations below, use an arrow to indicate the net movement of water into or out of the cell through the semipermeable plasma membrane (i.e. osmosis). (Assume that the sugar molecules cannot pass through the plasma membrane in each case.) 1% sugar (inside a circule) 3% sugar (inside a circule) 1% sugar (inside a circule) 5% sugar 1% sugar 1% sugar 3. In each of the drawings above, indicate if the inside of the cell...
1.) Conduct some research and describe the movement of water and minerals from the tip of...
1.) Conduct some research and describe the movement of water and minerals from the tip of the root to the top of the tallest tree. Be sure to start in the soil, describing the relationship of water molecules to soil particles, and end up in the atmosphere (What's the term for the evaporation of water? Be sure to describe the transition from liquid water to gas). The best place to begin is to describe the molecular structure of water, followed...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
3. (4 points) Briefly describe the path a protein made by ribosomes that are attached to the endoplasmic reticulum will follow through the endomembrane system in order to be exported from the cell. Include in your answer which other organelles the protein will move through, how the protein is moved from one organelle to another, and the process that a cell would use to export the protein. 4. Fill in the diagram below with what you learned about the cell...
Insulin is a protein which is synthesized and secreted by pancreatic cells. Describe the path insulin proteins would take through the cell from it's transcription in the nucleus to its secretion into the extracellular matrix. Describe the structure and function of all the organelles involved and describe what happens to insulin as it moves through endomembrane system. (10 marks)
Question 15 (2 points) ✓ Saved Select all of the following that are part of the extracellular matrix. Actin Fibronectin Myosin Collagen Question 16 (4 points) ✓ Saved Please put the following activities of translation initiation in order from first to last. 1 v Small subunit of ribosome binds to mRNA 4 v A-site is open 2 tRNA with anticodon UAC binds to mRNA codon AUG 3 large subunit of ribosome binds to mRNA Question 17 (2 points) ✓ Saved...
_____membranes proteins are associated with the bilayer through interactions with other membrane component on the surface of the membrane. Net movement of particles from a region where they are more concentrated to a region where they are law concentrated is called Diffusion of water through a selectively permeable membrane down its own concentration gradient It called A solution with an equivalent concentration of water and hence the tame osmotic pressure as the fluid inside the cell is said to be...
Part A - The Vocabulary of Protein Protein is involved in a wide range of important body functions, so adequate intake of it is essential While low protein intake can cause malnutrition and certain health conditions, too much protein can cause health problems as well Match the words in the left column to the appropriate blanks in the sentences on the right. ► View Available Hint(s) Reset Help hormones 1. Proteins called aid the immune system in its fight against...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago