Question

5. (5 pts.) Cells normally dont move from one tissue to another. But in late stages of cancer, cells move from one tissue to
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Mutations result in the formation of cancerous cells. Cancerous cells replicate in uncontrolable manner. Human system can't control their proliferation and death using cell signals. That is cancerous cell become irresponsible against cell signals.

During the initial stages of cancer , the cancer is appeared as benign. Benign tumours are those confined with in boundaries of tissue. Later stage of cancer, it is developed into malignant tumour. Malignant stage have the capability of breaking boundary and enter the nearby tissues. This terminal stage is knows as metastasis.

In metastasis, cancerous cell enters the blood stream , lymphatic system and thereby travels into new area of body. In those new area, they begin to divide and lay a basement for secondary tumours.

Add a comment
Know the answer?
Add Answer to:
5. (5 pts.) Cells normally don't move from one tissue to another. But in late stages...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • (5 pts.) Cells normally don't move from one tissue to another. But in late stages of...

    (5 pts.) Cells normally don't move from one tissue to another. But in late stages of cancer cells move from one tissue to another. Using what you know about cell connections, explain what would have to happen for cancer cells to move to a new tissue. IF

  • 1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What...

    1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...

  • Question 1 12 pts Mitchechterm with the best Probiotic Prebiotic Cheese) Graft of tissue from one...

    Question 1 12 pts Mitchechterm with the best Probiotic Prebiotic Cheese) Graft of tissue from one location to another in the same individual's body Molecules released by cytotoxic T cells and natural killer cells to induce programmed cell death (apoptosis) and so destroy target cells such as cancer cells or Graft of tissue from a donor of the same species as the recipient but not genetically identical Proteins released by Killer cells to destroy targeted cells by inserting pores in...

  • Critical Thinking Question (5 pts.) (You may use the back of the page to write your...

    Critical Thinking Question (5 pts.) (You may use the back of the page to write your answer if needed) Today you have learned about DNA, the cell cycle, chromosomes, and the special end-tips of the chromosomes called Telomeres. Each time a cell divides the Telomeres get shorter and shorter, until they get so short that a cell stops dividing and eventually dies This is a part of normal aging process. We know that stress can speed up the shortening of...

  • 1. Part A) If a random sample of cells from one of your organs such as...

    1. Part A) If a random sample of cells from one of your organs such as your liver or kidneys were checked under a microscope, doctors would expect to see ALL the cells in interphase. If a measurable number of cells were in mitosis, that would be a sign that you might have cancer or be close to developing cancer. Explain why the cells in your functioning organs SHOULD all be in INTERPHASE, not in mitosis. Hint: Make sure to...

  • Consider an organism that has 2 pairs of homologous chromosomes. Draw one of the cells from...

    Consider an organism that has 2 pairs of homologous chromosomes. Draw one of the cells from this organism as it would appear during late prophase I and during late metaphase I. What would happen to the gametes, if you treated the cell with Taxol, a drug the blocks spindle fiber formation immediately after meiosis I. Assume that the cell is still able to complete cytokinesis. Female armadillos always give birth to four offspring of the same sex. Suggest a mechanism...

  • Answer the following questions about histology(Connective tissue and plant cells) 1.Key characteristics of connective tissue(minimum 5)...

    Answer the following questions about histology(Connective tissue and plant cells) 1.Key characteristics of connective tissue(minimum 5) 2. the words “dense”, “loose”, “regular”, “irregular” means. If lacunae is seen in the tissue, the tissue must be ... or....? 3. Animal tissue-connective tissues: For Loose connective tissueCT Areolar tissue: a.Point the irregular arrangement of fibers b. hows the arrangement of the fibers c. what type of fibers can you find d. how do you differentiate them 4. Dense irregular CT: a. where...

  • 24. Which of the following mechanisms produces the most cells for tissue growth from stem cells?...

    24. Which of the following mechanisms produces the most cells for tissue growth from stem cells? a. The division of the stem cells themselves. b. The division of fully differentiated cells. C. The division of transit amplifying cells. d. The division of stromal/mesenchymal cells. 25. Which of the following would most likely promote cancer if it had a hyperactive mutation? a. E-Cadherin b. Cyclin D c. p27 d. Weet kinase 26. Snakes and lizards each have vertebrae and ribs. Which...

  • Question 3 What is the purpose of Stem Cell Therapy? Use of stem cells to prevent...

    Question 3 What is the purpose of Stem Cell Therapy? Use of stem cells to prevent an animal from aging once it reaches maturity Use of stem cells to create an embryo (without using a fertilized egg) Use of stem cells to create a new individual (for example the sheep Dolly) Use of stem cells to fix or replace tissues that have been damaged Use of stem cells to change one type of tissue into another (for example, muscle tissue...

  • Please help with answers to these questions answer the ones that are straightforward like this one...

    Please help with answers to these questions answer the ones that are straightforward like this one Question 24 5 pts 1. Beta-catenin is classified as a proto-oncogene and APC is classified as a tumor suppressor gene. Both are important parts of the Wnt signaling pathway. Describe the relationship between beta-catenin and APC. Explain in detail why they are classified as a proto-oncogene or tumor suppressor gene. 2. Suppose you're working in a cancer research lab and discover a small molecule...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT