since the voltage is decreased
from primary to secondary coil the transformer is a step down
transformer. I hope it's clear.
Question 2 Not yet answered Points out of 10.00 P Flag question A transformer has an...
Question 3 Not yet answered Points out of 10.00 P Flag question A building has a 40kW load using a 240V AC three-phase system. a) What is the total current needed for this system if the PF is 0.8? b) Based on the current calculated in part a, what size conductor is needed for this system if the feeder is to be aluminum rated for 90°C? c) If the service for this building is from underground, what type of conductor...
Not yet answered Points out of 10.00 P Has question A commercial building in downtown Portland, OR has a three-phase, 480 volt, 1200 ampere service. What is the required transformer size needed for this building? Make sure to show your work FT: BIOWEGO Maximum size for news SOOMB mamamatachments
1. If 480 volts is applied to the primary winding of a transformer which has 300 turns in the primary winding and 15 turns in the secondary winding, the secondary voltage will be A. 0.0417 volts. C. 56.8 volts B. 24 volts. D. 9600 volts. 2. A distribution transformer with a grain-orientented steel core is highly efficent because its A. exciting current is sufficiently high. B. flux direction is parallel to the stell-rolling direction C. permeability is increased due to...
Part A: A transformer with turns ratio (primary/secondary) of 18:1 is used to step down the voltage from a 120 V wall socket to be used in a battery charger. What is the voltage supplied to the recharger? Part B: The electric motor in a toy train requires a voltage of 9.0 V. Find the ratio of turns on the primary coil to the turns on the secondary coil in a transformer that will step the 120-V household voltage down...
The primary 40-turn coil of an ideal transformer is supplied with 120 V (rms). If the rms voltage output of the secondary coil is 15 V, how many turns are in the secondary coil, and what type of transformer is this? 8 turns, step-down transformer 5 turns, step-down transformer 15 turns, step-down transformer 320 turns, step-up transformer 160 turns, step-up transformer
1. A step down transformer with a turns ratio of 6 to 1 has 120V applied to its primary coil. A 25Ω load resistor is connected to the secondary coil. Calculate the following (3+2+2 -7 Points) Secondary coil voltage Secondary coil current Primary coil current a. b. c. 2. A step up transformer has a primary coil current of 1SA and an applied voltage of 220V. The secondary coil current is 5A. Calculate the following (3+3+2+2-10 Points) Secondary coil voltage...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....
Question 2 Not yet answered Points out of 10.00 P Flag question A first order process is found to have a rate constant of 32.3 s-1. How long does it take for the reactant concentration to decrease to one-fifth (1/5)? Select one: O A. 67.2 s OB. 0.00691 s OC. 0.223 s OD. 7.21 s O E. 0.0644 s Previous page Next page
Not yet answered Question 19 Points out of 2.00 P Flag question Emergency power for equipment that cannot experience any disruptions in service is typically furnished by UPS Select one: True False Question 20 Not yet answered Points out of 2.00 P Flag question Typically fuses cost less than circuit breakers, but take up more room in the panel. Select one: True False
A transformer has 490 turns in the primary coil and 140 in the secondary coil. Part A What kind of transformer is this? A. step-up B. step-down Part B By what factor does it change the voltage? Assume 100% efficiency. Part C By what factor does it change the current?