Question

            Assuming transcription and translation are taking place simultaneously, is the cell below a eukaryotic or prokaryotic cell?  Please explain your answer.

RNA polymerase DNA Ribosome Transcription Polypeptide- Translation MRNA

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The cell below is clearly prokaryotic because the transcription as well as translation are coupled and occur simultaneously.

Meanwhile, In eukaryotic cells, transcription occurs inside the nucleus and the mRNA is transported outside the nucleus into the cytoplasm where it is translated to generate protein.

feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.

Add a comment
Know the answer?
Add Answer to:
            Assuming transcription and translation are taking place simultaneously, is the cell below a eukaryotic or prokaryotic...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the...

    Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...

  • 3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...

    3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...

  • What is main difference between Prokaryotic and Eukaryotic DNA replication and transcription/ translation processes? what are...

    What is main difference between Prokaryotic and Eukaryotic DNA replication and transcription/ translation processes? what are the three ways mRNA gets processed prior to leaving the Nucleus? What is alternative splicing?

  • Mae each cellular component to a role in transcription or translation in eukaryotic cells. protein complex...

    Mae each cellular component to a role in transcription or translation in eukaryotic cells. protein complex that makes RNA polymers corresponding to a DNA template RNA polymerase Answer Bank location where transcription occurs TRNA region of DNA that recruits the transcriptional machinery promoter provides amino acids to growing protein chain ribosome site of protein synthesis nucleus about us | Careers privacy policy terms of use contact us help

  • Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...

    Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...

  • choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells...

    choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...

  • 1. Describe the differences between prokaryotic and eukaryotic translation initiation. How does the ribosome find the...

    1. Describe the differences between prokaryotic and eukaryotic translation initiation. How does the ribosome find the correct start codon and what proteins are involved in the process? please include the shine-dalgarno sequence in the answer. 2. Consider the following partial sequence of messenger RNA. The sequence below contains the code for a short, complete protein. 5 ́-UCCCCAGUCAUGGAGUCGUUAAUUAAAUGACCGGUGCGGAUCGUA - 3 ́ Using the codon chart (from your textbook or in the lecture slides), give the amino acid sequence of the protein...

  • moose the correct alphabet (letter, noting that each and may have only ch answer can be...

    moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...

  • Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic...

    Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...

  • Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...

    Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT