Question

E. coli/brings lactose into its cell by using an enzyme called Lac Permease. Once the lactose is inside, another enzyme called B-galactosidase converts the lactose into galactose and glucose. 1. How is E. colls way of dealing with lactose similar to how your celis do it? 2. How is it different?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. In the presence of glucose, the beta-galactosidase enzyme is not produced and as a result lactose metabolism doesn't take place. In humans also if the lactase enzyme is not present then the metabolism of lactose doesn't occur and this leads to lactose intolerance.

2. In case of humans, the enzyme required for lactose metabolism is Lactase and in case of E.coli, the required enzyme is beta- galactosidase. The products formed in both the cases is glucose and galactose.

Add a comment
Know the answer?
Add Answer to:
E. coli/brings lactose into its cell by using an enzyme called Lac Permease. Once the lactose...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • What happens to the expression of the Lac gene of E. coli if the following conditions...

    What happens to the expression of the Lac gene of E. coli if the following conditions occur? For each condition below, mark an X in the column labelled Activated or Repressed, then explain why you chose that answer. Please assume the glucose levels are low in the cell. The first row is done for you. Activated a Repressed b Explain your answer Repressor, Lactose, and RNA polymerase are all present in abundance X Repressor binds to lactose so it can...

  • The gene machine program shows you what happens when lactose is present in E. coli, and...

    The gene machine program shows you what happens when lactose is present in E. coli, and how the lac operon is under negative control. However, the lac operon is also under positive control from a protein called CRP, eAMP Receptor Protein. The absence of the lac repressor is essential but not sufficient for effective transcription of the lac operon. RNA polymerase also depends on the presence of CRP. Like the lac repressor, which can bind to the DNA and lactose....

  • The lac operon in E. coli is a well-studied gene system, and β-galactosidase (β-gal) is the...

    The lac operon in E. coli is a well-studied gene system, and β-galactosidase (β-gal) is the product of the lacZ gene. The diploid conditions represent the addition of a plasmid carrying different components of the lac operon. Determine if β-gal will be generated under the conditions. Assume that glucose is absent. A + in the genotype indicates a functioning gene, while a – indicates a loss-of-function allele. The OC is an operator mutant that cannot bind the lacI protein. Use...

  • 2. Suppose you have six strains of E. coli. One is wild type, and each of the other five has a single one of the follow...

    2. Suppose you have six strains of E. coli. One is wild type, and each of the other five has a single one of the following mutations: lacZ, lacY, laď·0; and lach. For each of these six strains, describe the phenotype you would observe using the following assays. Explain your answers. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expression but cannot serve as a carbon source for bacterial growth because it...

  • plz answer the first question PART 3: THE BIGGER PICTURE It is estimat adultho 5% in...

    plz answer the first question PART 3: THE BIGGER PICTURE It is estimat adultho 5% in nort trio. in northern Europe, to 71% estimated that 75% of adults worldwide show some decrease in lactase activity during od (due to gene regulation). The frequency of decreased lactase activity ranges from in some African and Asian con in Sicily, to more than 90 e This distribution is now thought to have been caused by recent natural selection favoring lactase-persistent individuals in cultures...

  • Six E. colimutants were isolated. The activity of the enzyme beta-galactosidase produced by the cells was...

    Six E. colimutants were isolated. The activity of the enzyme beta-galactosidase produced by the cells was measured when the cells were grown in medium supplemented with different carbon sources. Put your answer into the right-hand column of the table. Glycerol Lactose Lactose + Glucose Mutation in Wild-type 0 1000 10 -------- Mutant 1 0 10 10 Mutant 2 1000 1000 10 Mutant 3 0 0 0 Mutant 4 0 1000 10 Mutant 5 1000 1000 10 Mutant 6 0 0...

  • Yet, all the cells in your body contain the same genes (and same alleles). The difference...

    Yet, all the cells in your body contain the same genes (and same alleles). The difference across cell types is that genes get selectively expressed (turned on or off) based on the proteins needed for cellular function given their environment. Select which statement explains the reason why hair does not normally grow on your muscle cells. a. Muscle cells have the gene for keratin, but do not express it b. Muscle cells do not have the gene for keratin and...

  • Curli are cell surface filaments that are found on pathogenic bacteria such as E. Coli and...

    Curli are cell surface filaments that are found on pathogenic bacteria such as E. Coli and Salmonella. These filaments are thought the help bacterial adhere to surfaces, to facilitate bacterial interaction with cells, and to form biofilms. In a general sense, Curli are thought to help bacterial pathogenicity. Curli filaments are composed of the protein CsgA (Curli Specific Gene A). CsgA is synthesized in the cytosol (as all proteins are) and then transported (though the inner membrane, the periplasm and...

  • 5. Here is another promoter region in E. coli. (Also in a larger format in the...

    5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...

  • LAB Genetic Engineering of Bacteria Problem Is it possible to transfer the allele for resistance to...

    LAB Genetic Engineering of Bacteria Problem Is it possible to transfer the allele for resistance to the antibiotic ampicillin into a bacterial cell? Objectives After completing this lab, the student will be able to: 1. Demonstrate micropipetting and sterile pipetting techniques for handling and transferring bacteria and plasmid DNA. 2. Maintain sterile conditions for culturing bacterial cells. 3. Inoculate bacteria into flasks, culture tubes, or agar plates. 4. Culture isolated individual colonies from an agar plate to form genetically identical...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT