Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation...
Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation or alteration of histone proteins is referred to as _____ changes.
A. epigenetic
B. sensitivity
C. mutational
D. genetic
Homework Answers
Epigenetic changes
This chages refer to modification of the DNA, not of the sequence of DNA but of its structure, chaging the structure of chromatin leads to diferent expretion in genes. The chages in the structur can be made trhou methulation, the ading of a methyl group (CH3) to the DNA chain.
Add Answer to:
Alterations of chromatin of DNA structure that are stable and
inheritable in offspring via DNA methylation...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Which statements about the modification of chromatin structure in eukaryotes are true? 2 pts a. Acetylation...
Which statements about the modification of chromatin structure in eukaryotes are true? 2 pts a. Acetylation of histone tails in chromatin allows access to DNA for transcription. b. Histone proteins are always permanently placed along a DNA sequence but the binding to DNA can be loosened. c. Methylation of DNA is associated with the gene activation. d. Acetylation of histone tails is a reversible process. e. Some forms of chromatin modification can be passed on to future generations of cells.
Which of the following hypothesizes that the physical and functional status of a certain region of genomic chromatin is dependent upon the patterns of specific histone posttranslational modifications...
Which of the following hypothesizes that the physical and functional status of a certain region of genomic chromatin is dependent upon the patterns of specific histone posttranslational modifications and/or DNA methylation status? a. PTM hypothesis b. Nuclear body hypothesis c. Epigenetic code d. Genetic code
Regulation of Gene Expression in Eukaryotes Part A -Modification of chromatin structure Which statements about the...
Regulation of Gene Expression in Eukaryotes Part A -Modification of chromatin structure Which statements about the modification of chromatin structure in eukaryotes are true? Select all that apply. View Available Hint(s) Acetylation of histone tails is a reversible process Some forms of chromatin modification can be passed on to future generations of cells. DNA is not transcribed when chromatin is packaged tightly in a condensed form. O Acetylation of histone tails in chromatin allows access to DNA for transcription. Deacetylation...
What does the phrase "epigenetic transgenerational inheritance of disease susceptibility" mean? Question options: a) changes to...
What does the phrase "epigenetic transgenerational inheritance of disease susceptibility" mean? Question options: a) changes to factors that affect gene expression, that are passed down to offspring, and affect whether or not offspring will get a particular disease b) changes to DNA sequences, that are passed down to offspring, and affect whether offspring will get a particular disease c) changes to factors that affect gene expression, that can be passed on from offspring to parents, and affect whether or notparents...
Which of the following is not true of DNA methylation? A.The methyl group is attached via...
Which of the following is not true of DNA methylation? A.The methyl group is attached via a strong carbon-carbon bond B.It is heritable across cell division C. t is considered stable enough to mediate X-inactivation D. It interferes with cytosine-guanine binding
a. What is the difference between DNA and chromatin? Name one type of molecule that distinguishes...
a. What is the difference between DNA and chromatin? Name one type of molecule that distinguishes these two forms of genetic information. b. What is a nucleosome, and what role does it play in cells? c. Why does DNA need to be compacted inside cells? d. Are any proteins used to keep DNA compacted other than proteins already present in chromatin?
In eukaryotes, genomic DNA is wrapped around the histone complex to make chromatin. The direct contacts...
In eukaryotes, genomic DNA is wrapped around the histone complex to make chromatin. The direct contacts between DNA and the histone beads interfere bindings of the transcriptional factor proteins to their cognate sequence elements, decreasing gene activities. To increase transcriptional activity of the affected genes, the RSC/CRC complex remodels chromatins such that the ________ sequences can be amenable to formation of the transcriptional initiation complex. Select one: a. TBP-binding and TAP-binding b. Shine-Dalgarno c. start codons d. All of these...
How do epigenetic traits differ from traditional genetic traits, such as the differences in color and...
How do epigenetic traits differ from traditional genetic traits, such as the differences in color and shape of peas that Mendel studied? A) Phenotype is stably inherited by offspring. B) Phenotype is not transmitted to offspring. C) New phenotype involves changes to the DNA sequence. D) New phenotype is caused by modifications to chromatin. E) Phenotype can be influenced by environmental factors.
The observation that in any DNA sample, A T and G C A. DNase sequencing An...
The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Regulation of Gene Expression in Eukaryotes Part A -Modification of chromatin structure Which statements about the modification of chromatin structure in eukaryotes are true? Select all that apply. View Available Hint(s) Acetylation of histone tails is a reversible process Some forms of chromatin modification can be passed on to future generations of cells. DNA is not transcribed when chromatin is packaged tightly in a condensed form. O Acetylation of histone tails in chromatin allows access to DNA for transcription. Deacetylation...
The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago