Question

In the segment of mRNA transcript below, a single nucleotide substitution occurred where the second guanine...

In the segment of mRNA transcript below, a single nucleotide substitution occurred where the second guanine from the 5' end was switched to a uracil. What would be the resultant change in the amino acid sequence in the polypeptide that was made from this transcript?

In the segment of mRNA transcript below, a single

asn-ser-arg
no change
ser-
asn-leu-val
gln-ser-ser
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

5'-AGC-GGA-CAA-3'

Ser-Gly-Gln

If second base from 5' end, guanine is replaced by uracil the first aminoacid shift serine to isoleucine

Add a comment
Know the answer?
Add Answer to:
In the segment of mRNA transcript below, a single nucleotide substitution occurred where the second guanine...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • 2. A single nucleotide addition and a single nucleotide deletion approximately 15 base pairs apart in...

    2. A single nucleotide addition and a single nucleotide deletion approximately 15 base pairs apart in the DNA cause a protein change in sequence friom Old Phe-Ser-Pro-Arg-Leu-Asn-Ala-Val-Lys to ne Phe-Val-His-Ala-Leu-Met-Ala-Val-Lys a. What are the old and new mRNA nucleotide sequences? Old 5' uu Au b. Which nucleotide has been added? Which has been deleted?

  • This sequence is RNA because:

    20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...

  • A single nucleotide deletion in the DNA causes a protein change in sequence from Ser –...

    A single nucleotide deletion in the DNA causes a protein change in sequence from Ser – Thr – Ile – Ser – Gly – Ala – Arg – Leu To Ser – Thr – Leu – Ala – Glu – Pro – Val What are the old and new mRNA nucleotide sequences?

  • Shown below are the amino acid sequences of the wild-type and three mutant forms of a...

    Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition / transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met – gln – ala – ser – val – arg – phe Mutant 1:...

  • i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded?...

    i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro

  • A substitution mutation is one in which one nucleotide base is changed to another

    2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...

  • Shown below are the amino acid sequences of the wild-type and three mutant forms of a...

    Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition/transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met - gin-ala - ser-val - arg - phe Mutant 1: met - gln - pro-ser -...

  • On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...

    On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT