#include <stdio.h>
#define N 8
int main() {
char myVar = 'N';
int i;
for(i = N-1; i >= 0; i--)
printf("%c", *((long *) &myVar) & 1 << i ? '1' : '0');
printf("\n");
return 0;
}





1. [17 pts, 1/line] Modify the following code to display the binary information stored at a...
Using Microsoft Visual Studio. 1) Complete the following C++ program by adding more line of code for 8-bit signed array, 16-bit unsigned array, 16-bit signed array, 32-bit signed array and 32-bit signed array. 2) Fill in all the blanks in Table 1 using your completed code, following the hints provided within the table. 3) Fill in all the blanks in Table 2 using your completed code, following the hints provided within the table. C++ Program #include <stdio.h> #include <iostream> int...
A)Correct this code and explain what was corrected // C code - For Loop / Array Population // This program will populate integers into an array, and then display those integers. // Developer: Johnson, William CMIS102 // Date: Mar 4, 2020 // Global constants #define INTLIMIT 10 #include <stdio.h> // This function will handle printing my name, class/section number, and the date void printStudentData() { char fullName[19] = "William J. Johnson"; char classNumber[9] = "CMIS 102"; char sectionNumber[5] = "4020";...
// C code // If you modify any of the given code, the return types, or the parameters, you risk getting compile error. // Yyou are not allowed to modify main (). // You can use string library functions. #include <stdio.h> #include <stdlib.h> #include <string.h> #pragma warning(disable: 4996) // for Visual Studio #define MAX_NAME 30 // global linked list 'list' contains the list of patients struct patientList { struct patient *patient; struct patientList *next; } *list = NULL; ...
Can i get help with this C program requirement. Modify the program Figure 2.13 (letter/while). Create a variable at the top of your code named power2 and assign it the value 8 Create a variable at the top of your code named result and assign it the value 0 Ask the user to enter FOUR 1's and 0's followed by a '*' In the loop, when the letter is '1' add power2 to result and store it back into result...
How do i finish this code: #include <stdio.h> int main() { long long decimal, tempDecimal, binary; int reminder, weight = 1; binary = 0.0; //Input decimal number from user printf("Enter any decimal number: "); scanf("%lld", &decimal); // Since we do not want change the value of decimal in the code // let us use tempDecimal to store the value of decimal tempDecimal = decimal; printf("\n\n"); // Let us use while loop first to implement printf("while loop part:\n"); /**************START FROM HERE...
I need to modify below code to have output like: Example: RBGY [ You have 1 white flag and you have 1 red flag] Example: CCGG [ You have 0 white flag and you have 1 red flag] ================================== #include <stdio.h> #include <string.h> #include <time.h> #include <stdlib.h> #define SIZE_STRING 4 #define SIZE_STRING_LONG 15 int main(int argc, char *argv[]){ if(argc != 2) { printf("Usage: ./main <scComputer>"); exit(0); } char szUser[SIZE_STRING_LONG]; char *szComputer = argv[1]; int counter=0; int colour=0; int position=0; char...
Please help in C: with the following code, i am getting a random 127 printed in front of my reverse display of the array. The file i am pulling (data.txt) is: 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 when the reverse prints, it prints: 127 9 8 7 6 5 4 3 2 1 0 9 8 7 6 5 4 3 2 1 not sure why...please...
Please Modify the following program, paste your code and show the execution result capture /** * Basic execl() Usage. * * By walking through this example you’ll learn: * - How to use execl(). * - What happens to the process that invoked execl(). * */ #include #include int main(int argc, char* argv[]){ printf("%s executing `ls -l`.\n", "Before"); // HINT: The /bin/ls -l should be executed. execl(); printf("%s executing `ls -l`.\n", "After"); return 0; }
Memory Consider a process running the following program #include estdlib.h> #include #define const char* int int <stdio.h> TO PRINT toPrintCPtr "Good luck!" TO PRINT; main for (i -0; i < sizeof (TO PRINT)-1; i++) printf("%c %c\n", toPrintCPt r [1], toupper(toPrintCPt r [i])); return(EXIT SUCCESS); Please tell where the following objects are stored in memory. Your choices are a. ROM BIOS b. kernal Memory (the OS) c. shared library memory (the glibc library) d. .text segment e. .rodata segment f. .data...
Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working. Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows: ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example,...