Homework Answers
Add Answer to:
please help!
Class Participation Q #2 amino acid is formed using following reactions? What the a...
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D....
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
For the following DNA strand, what is the amino acid chain that would result in the cell?
For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro
please help with these 5 questions Consider a polypeptide consisting of 19 amino acid residues. Its...
please help with these 5
questions
Consider a polypeptide consisting of 19 amino acid residues. Its structure is shown below. Lys-Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln-Tyr . Draw the fragments that would result if the peptide was treated with trypsin. (No partial credit) . Draw the fragments that would result if the peptide was treated with chymotropsin. (No partial credit) MATCH a term from the list below to each definition. Place the letter of the term in the blank to the left of the definition...
A tRNA's anticodon is 5'GGC3! What amino acid is attached to it? Second base Uud Phenyia...
A tRNA's anticodon is 5'GGC3! What amino acid is attached to it? Second base Uud Phenyia UA Tyrosine (Tyr) UAA Stop codon WA G Stop codon Yad Cysteine (Cys) (UGTA Stop codon (WE ) Tryptophan (Tip) MUG Leucine (Leu) CES Prol CA Histidine (is) EAG Gutamine (G) Arginine (Arg) First base Third base AAAsparagine AAC (Asn) soleucine (llo) Methionine (Met) IACA start codon Threonine (Thr) AG Serine (Ser) AG Arginine (Arg) AUG AAA Lysine (Lys) SAU Aspartic acid GAC (Asp)...
C,D, and E i need help with. 17. The following peptide forms part of Human Hemoglobin...
C,D, and E i need help with.
17. The following peptide forms part of Human Hemoglobin subunit gammaa Asp-Leu-Lys-Gly-Thr-Phe-Ala A) Which amino acids are likely to be on the side of peptid acids are likely to be on the side of peptide that faces the interior of the protein? Insert your answer leu, Gto.Pne, Ala B) Which are likely to be facing the aqueous environment? Insert your answer Asp, lys, Thr Draw the structure of the sequence at pH7.4. Using...
a. Using the table below, predict the secondary structure most likely adopted by the heptapeptide "RANGEHEAL". W...
a. Using the table below, predict the secondary structure most
likely adopted by the heptapeptide "RANGEHEAL". Will it be
alpha-helical, beta-strand, or just random coil?
b. Hydrogen bonds between backbone residues stabilize
interactions between
helixes and
sheets. Knowing this and other information about hydrogen bonds,
which amino acid from the picture below will destabilize secondary
protein structure?
Conformational Preferences of the Amino Acids Preference Amino acid a-helix B-strand Reverse turn Glu 1.59 0.52 1.01 Ala 1.41 0.72 0.82...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...
1)Match the name of each amino acid with one of its characteristics. 2)has a hydroxy group...
1)Match the name of each amino acid with one of its characteristics. 2)has a hydroxy group its aromatic side chain 3)has a sulfur atom in its side chain that can form disulfide bonds its side chain is a nonpolar isopropyl group 4)it has the smallest acidic side chain 5)this amino acid has the smallest side chain of all, a hydrogen atom 6)its side chain is a methyl group its side chain of 3 carbons forms a 5-membered ring with the...
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro
please help with these 5
questions
Consider a polypeptide consisting of 19 amino acid residues. Its structure is shown below. Lys-Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln-Tyr . Draw the fragments that would result if the peptide was treated with trypsin. (No partial credit) . Draw the fragments that would result if the peptide was treated with chymotropsin. (No partial credit) MATCH a term from the list below to each definition. Place the letter of the term in the blank to the left of the definition...
A tRNA's anticodon is 5'GGC3! What amino acid is attached to it? Second base Uud Phenyia UA Tyrosine (Tyr) UAA Stop codon WA G Stop codon Yad Cysteine (Cys) (UGTA Stop codon (WE ) Tryptophan (Tip) MUG Leucine (Leu) CES Prol CA Histidine (is) EAG Gutamine (G) Arginine (Arg) First base Third base AAAsparagine AAC (Asn) soleucine (llo) Methionine (Met) IACA start codon Threonine (Thr) AG Serine (Ser) AG Arginine (Arg) AUG AAA Lysine (Lys) SAU Aspartic acid GAC (Asp)...
C,D, and E i need help with.
17. The following peptide forms part of Human Hemoglobin subunit gammaa Asp-Leu-Lys-Gly-Thr-Phe-Ala A) Which amino acids are likely to be on the side of peptid acids are likely to be on the side of peptide that faces the interior of the protein? Insert your answer leu, Gto.Pne, Ala B) Which are likely to be facing the aqueous environment? Insert your answer Asp, lys, Thr Draw the structure of the sequence at pH7.4. Using...
a. Using the table below, predict the secondary structure most
likely adopted by the heptapeptide "RANGEHEAL". Will it be
alpha-helical, beta-strand, or just random coil?
b. Hydrogen bonds between backbone residues stabilize
interactions between
helixes and
sheets. Knowing this and other information about hydrogen bonds,
which amino acid from the picture below will destabilize secondary
protein structure?
Conformational Preferences of the Amino Acids Preference Amino acid a-helix B-strand Reverse turn Glu 1.59 0.52 1.01 Ala 1.41 0.72 0.82...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago