What protein products would be made by the mutant gene in the prescence of each of the following tRNAs:
-Serine-inserting amber [UAG] suppressor?
-Tyrosine-inserting ochre [UAA] suppressor?
-Glutamine-inserting opal [UGA] suppresor?
The three codons UAG (Amber), UAA (Ochre), and UGA (Opal) are usually translation termination signals. Three proteins, called release factors, are also required for termination. Release Factor 1 is required for termination at UAG and UAA codons, release factor 2 is required for termination at UAA and UGA codons, and release factor 3 accelerates the release of ribosomes from the mRNA. Cells contain about 1 molecule of release factor per 5 ribosomes.
Nonsense suppressors. Nonsense suppressors are produced by base substitution mutations in the DNA corresponding to the anticodon of a tRNA that cause the anticodon to pair with one of the terminarion (or "nonsense") codons, UAG (Amber), UAA (Ochre), or UGA (Opal). Examples of nonsense suppressors produced by single base substitutions in E. coli are shown in the following table. Note that because of the wobble rules amber suppressing tRNAs can only read UAG codons, but ochre-suppressing tRNAs can read both UAA and UAG codons.
Serine-inserting amber [UAG] suppresso :leu-ser-pro-lys-trp-lys-stop
Glutamine-inserting opal [UGA] suppresor : leu-ser-pro-lys-stop
-Tyrosine-inserting ochre [UAA] suppressor : leu-ser-pro-lys-trp-lys-stop
What protein products would be made by the mutant gene in the prescence of each of...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Bring this DNA sequence to protein using the transcription
(3pts) and translation (4 pts) processes.
note: Pending the direction your DNA is located
Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...