Question

draw a schematic of a two nucleotide long single stranded DNA and indicate the 5' end...

draw a schematic of a two nucleotide long single stranded DNA and indicate the 5' end 3'end. You do not have to draw the structure of the base, innstead you can indicate them as B1 and B2. makr sure you draw the sugar and phosphate explicity with the ring numbering for the sugar.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

# 2 Nucleatde long Squs uy our end 5 он Base qinuclohdi. PhosPhak<e. Но 5-3 an Sug an но alcohol at a Phosphalet sugar t nl-

Add a comment
Know the answer?
Add Answer to:
draw a schematic of a two nucleotide long single stranded DNA and indicate the 5' end...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You can tell that this is an image of a DNA nucleotide and not an RNA...

    You can tell that this is an image of a DNA nucleotide and not an RNA nucleotide because you see a O PO 0I double-stranded molecule, not a single-stranded molecule O uracil nitrogenous base, not a thymine nitrogenous base O O sugar with two, and not three, oxygen atoms thymine nitrogenous base, not a uracil nitrogenous base phosphate group, not a uracil O O Submit Request Answer

  • Draw DNA with the sequence 5’-ACTAG-3’. Label the sugar ring, the phosphate, the base, the 5’...

    Draw DNA with the sequence 5’-ACTAG-3’. Label the sugar ring, the phosphate, the base, the 5’ end and the 3’ end of the molecule. Across from it, draw the sequence it would bind to, labeling the sugar ring, the phosphate, the base, the 5’ end and 3’ end. When drawing out the DNA sequence, please draw it out with atom symbols (such as O, P, H, C, etc) and their bond type (such as single bond ( --) or double...

  • Question 7 What is the structure of DNA at the level above the nucleotide? Ladder-like double...

    Question 7 What is the structure of DNA at the level above the nucleotide? Ladder-like double helix with sugar phosphate backbone forming the rungs of the “ladder” Single-stranded helical structure with sugar phosphate backbone connecting individual nucleotides Single-stranded helical structure with complementary base pairs connecting individual nucleotides Ladder-like double helix with complementary base pairs forming the rungs of the “ladder”

  • 58) Edwin Chargaff discovered that the nucleotide composition of DNA varies from one species to another....

    58) Edwin Chargaff discovered that the nucleotide composition of DNA varies from one species to another. However, nucleotide composition always follows certain rules. Use these rules to make deductions about the structure of a particular DNA molecule by completing the table below. Nucleotide Presence in DNA sample (%) Adenine Cytosine Guanine thymine 59) Using the data from the table above to draw a stretch of a double-stranded DNA molecule that is 20 base pairs long (hint: in the table above,...

  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

  • Refer to the schematic below. Which statement(s) describe(s) mistakes in this DNA structure? (Select all that...

    Refer to the schematic below. Which statement(s) describe(s) mistakes in this DNA structure? (Select all that apply.) A. In this drawing of two deoxyribonucleotides in a phosphodiester bond, there should be a double bond in each phosphate group. B. In this drawing of two deoxyribonucleotides in a phosphodiester bond, the phosphate of the top nucleotide has enough O atoms. C. In this drawing of two deoxyribonucleotides in a phosphodiester bond, the number of O atoms in the bottom phosphate is...

  • a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone...

    a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone vertically down the page. Please draw a 5' phosphate and 3' hydroxyl. b) Please draw just the bases of the complementary strand, including a "squggle bond" to indicate the attachment to the ribose; mark hydrogen bonds with the standard dashed lines. c) Please label the bases of both strands with their names. d) Please explain why you would lose points in part c if...

  • Question 2a Deoxyribonucleic acid (DNA) is made up of nucleotides. Which part of the nucleotide stabilizes...

    Question 2a Deoxyribonucleic acid (DNA) is made up of nucleotides. Which part of the nucleotide stabilizes the structure of DNA using weak van der Waals interactions (stacking) and using hydrogen bonds? (Note that covalent bonds are not included in that sentence.) a. the deoxyribose sugar b. the ribose sugar c. the phosphate d. the nitrogenous base e. the amino acid Question 2b This ability of the nitrogenous bases to exist in more than one form can lead to incorporation of...

  • bio 151 please and thank you QUESTION 8 When looking at one DNA nucleotide, the phosphate...

    bio 151 please and thank you QUESTION 8 When looking at one DNA nucleotide, the phosphate group is located on carbon #1 of the sugar. True False QUESTION 9 Which statement below is TRUE? thymine and adenine both have double ring bases O guanine is a smaller base than cytosine cytosine and thymine are both pyrimidine bases O adenine and guanine are complementary base pairs QUESTION 13 Which enzyme below is associated with 'unzipping" the DNA? ODNA Helicase Primase O...

  • Question 1 1 pts Why is it important for DNA to have complementary base pairing? O...

    Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT