Homework Answers
Add Answer to:
-2. Which of the following tripeptides would carry a net charge of-1 at pH 7? Markallthatapply....
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...
What two restriction enzymes could you use if you wanted to
produce a protein that was fused to a GST-tag that could be removed
using thrombin? Would this experimental design place any other tags
on your protein?
Here is the vector:
T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
Tyr-Lys-Met Gly-Pro-Arg Asp-Trp-Tyr Asp-His-Glu Which one of the above tripeptides Leu-Val (a) is most negatively charged...
Tyr-Lys-Met Gly-Pro-Arg Asp-Trp-Tyr Asp-His-Glu Which one of the above tripeptides Leu-Val (a) is most negatively charged at pH 7? (b) will yield DNP-tyrosine when reacted with I-fluoro-2.4-dinitro acid? (e) contains the largest number of nonpolar R (d) contains sulfur? (e) will have the greatest light absorbance at 280 nm? A) (a) D, (b) A (c) E: (d) A, (e) C, B) (a) A: (b) D, (c) E, (d) A, (e) C, C)(a) D, (b) E. (e)A (a A
Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the...
Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the following stretches of amino acid residues would you expect to find in the interior of protein molecules? O Gly-Tyr-His-Arg-His O Ala-Val-Leu-lle-Trp O Ala-Asp-Asp-Tyr-Arg O Gly-Lys-Ser-Pro-Thr OPhe-Glu-Gin-Glu-Asn QUESTION 3 2 points Save Answer The observation that proteins often renature into their original conformations after
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG...
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Match the following phenotypes with the mutation that would be the most likely to be its...
Match the following phenotypes with the mutation that would be the most likely to be its cause. The mutant proteins are listed below, followed by the protein domain that is mutated in each case, followed by the amino acid change that is a result of the mutation Try to answer each question by using the following reasoning: if you observe a phenotype, then that could be due to a mutation in protein in which the domain has had an amino...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...
Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation...
Adenosine deaminases modify adenosines to form
_____________________, which is then read as
_________________________ by the translation and splicing systems,
as well as by reverse transcriptase.
Cephalopods like squid and octopus use this form of editing very
extensively in their protein-coding regions. For each of
the following, please indicate how these enzymes can alter the mRNA
to produce the indicated codon changes.
I (Ileu) is changed to V (val):
K (Lys) is changed to E (Glu):
T (Thr) is changed to A (ala):...
The following genomic DNA sequence comes from the first exon of a human gene and contains...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
5 pts Question 33 The following prokaryotic DNA (same as above) is transcribed into RNA and...
5 pts Question 33 The following prokaryotic DNA (same as above) is transcribed into RNA and the MRNA transcript is translated into protein. 31 21 11 1 ATGGGTTACT ATGAGGAGTT GACACACAAG AGGAGGTAGC 71 61 51 41 AGTATGGGTA TAATCTAATG CGTAATTGAG GAGGTAGTTG 101 111 91 81 ACGTATGCAT AGATAACGTA CGGGGGGGAA ACCCCCCCTT 141 131 121 TTTTTTTTTC GAGCAATAAA AGGGTTACAG Useful sequences: -35: 5' TTGACAT 3', -10: 5' TATAAT 3 (Pribnow box), Shine Dalgarno sequence: 5' AGGAGGU 3 THE GENETIC CODE THE GENETIC CODE SECOND LETTER A...
What two restriction enzymes could you use if you wanted to
produce a protein that was fused to a GST-tag that could be removed
using thrombin? Would this experimental design place any other tags
on your protein?
Here is the vector:
T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
Tyr-Lys-Met Gly-Pro-Arg Asp-Trp-Tyr Asp-His-Glu Which one of the above tripeptides Leu-Val (a) is most negatively charged at pH 7? (b) will yield DNP-tyrosine when reacted with I-fluoro-2.4-dinitro acid? (e) contains the largest number of nonpolar R (d) contains sulfur? (e) will have the greatest light absorbance at 280 nm? A) (a) D, (b) A (c) E: (d) A, (e) C, B) (a) A: (b) D, (c) E, (d) A, (e) C, C)(a) D, (b) E. (e)A (a A
Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the following stretches of amino acid residues would you expect to find in the interior of protein molecules? O Gly-Tyr-His-Arg-His O Ala-Val-Leu-lle-Trp O Ala-Asp-Asp-Tyr-Arg O Gly-Lys-Ser-Pro-Thr OPhe-Glu-Gin-Glu-Asn QUESTION 3 2 points Save Answer The observation that proteins often renature into their original conformations after
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Match the following phenotypes with the mutation that would be the most likely to be its cause. The mutant proteins are listed below, followed by the protein domain that is mutated in each case, followed by the amino acid change that is a result of the mutation Try to answer each question by using the following reasoning: if you observe a phenotype, then that could be due to a mutation in protein in which the domain has had an amino...
The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...
Adenosine deaminases modify adenosines to form
_____________________, which is then read as
_________________________ by the translation and splicing systems,
as well as by reverse transcriptase.
Cephalopods like squid and octopus use this form of editing very
extensively in their protein-coding regions. For each of
the following, please indicate how these enzymes can alter the mRNA
to produce the indicated codon changes.
I (Ileu) is changed to V (val):
K (Lys) is changed to E (Glu):
T (Thr) is changed to A (ala):...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
5 pts Question 33 The following prokaryotic DNA (same as above) is transcribed into RNA and the MRNA transcript is translated into protein. 31 21 11 1 ATGGGTTACT ATGAGGAGTT GACACACAAG AGGAGGTAGC 71 61 51 41 AGTATGGGTA TAATCTAATG CGTAATTGAG GAGGTAGTTG 101 111 91 81 ACGTATGCAT AGATAACGTA CGGGGGGGAA ACCCCCCCTT 141 131 121 TTTTTTTTTC GAGCAATAAA AGGGTTACAG Useful sequences: -35: 5' TTGACAT 3', -10: 5' TATAAT 3 (Pribnow box), Shine Dalgarno sequence: 5' AGGAGGU 3 THE GENETIC CODE THE GENETIC CODE SECOND LETTER A...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago