Question

Match the following phenotypes with the mutation that would be the most likely to be its cause. The mutant proteins are liste
ProteinDomain A) Pol III B) ol Dndng Mutations Thumb domai Asp to Ala Asp to Ala Asp to Ala Pol III C) Pol III D) SBP E) SBP
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answers:

1. N: Histone H1 : Arg to Ala

2.Pol III : Finger domain: : Asp to Ala

3.S) Sliding clamp : PolII binding domain: Ala to Gln

4.D) SBP : DNA binding protein:Arg to LyS

Add a comment
Know the answer?
Add Answer to:
Match the following phenotypes with the mutation that would be the most likely to be its...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 11.Which of the following mutations would most likely to disrupt the structure of an α-helix? Cys...

    11.Which of the following mutations would most likely to disrupt the structure of an α-helix? Cys to Ala Lys to Arg Glu to Gly Val to Leu 12.Which amino acid combination is the most preferred to occupy positions 1 and 4 in an α-helix? Glu and Lys Phe and Pro Lys and Arg Asp and Glu 13.If each turn in the standard alpha helix extends 5.4 A and there are 3.6 amino acid residues per turn, how many amino acids...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • Question 25 3 pts Given the following DNA template, the sequence of the protein made is:...

    Question 25 3 pts Given the following DNA template, the sequence of the protein made is: 5'-AGC TCG AAT TCG CTT CAT GCT AGC TAG------(+1)--------(-10) ----------(-35) Leu-Ala-Cys-Met-Lys-Arg.lle-Arg-Ala Asp-Arg-Ser-Tyr-Phe-Ala-Stop Met-Ala-Ser-Stop Met-Lys-Arg-lle Arg-Ala Ser-Ser-Asp-Ser-Leu-His-Alo Ser-Stop 3 pts Question 30 In a cancer genomes database, you find multiple mutations in the BMV gene in several types of cancers. The majority of these cancer-associated mutations are heterozygous (having also one wild type allele), and expression of these mutant versions of BMV in normal cells...

  • You have a small gene that encodes the following amino acid: N-MET-ASP-SER-VAL-ALA-ARG-PHE-MET-TRP-C. There is a single...

    You have a small gene that encodes the following amino acid: N-MET-ASP-SER-VAL-ALA-ARG-PHE-MET-TRP-C. There is a single mutation in the DNA that causes a change in the amino acid sequence to: N-MET-VAL-GLN-TRP-PRO-ASP-LEU-CYS-GLY-C. a) What kind of mutation is this? Explain. (2 points) b) Indicate the DNA sequence (coding strand) of the gene. Show the original DNA sequence then the mutated sequence. Wild type DNA: Mutant DNA: You have another mutation (a different mutation from the one described in parts a and...

  • The DNA sequence below is copied from question 30 and has a mutation (highlighted in yellow)....

    The DNA sequence below is copied from question 30 and has a mutation (highlighted in yellow). TACGTACATACT 1) Transcribe the new sequence. 2) Translate the new sequence. What is the mutation? Original sequence: TACGTCCATACT Mutated sequence: TACGTACATACT (Glu) (Asp) Aspartic acid Glutamic acid Serine (Ser) Alanine (Ala) GU Jc Tyrosine (Tyr) A U Valine (Val) G А G Cysteine (Cys) с с U GTyptophan (Trp) START HERE Arginine (Arg) G U с A C Leucine (Leu) Serine (Ser) А с...

  • Question 20 (1 point) Figure out the mutation. You will need the codon table to answer...

    Question 20 (1 point) Figure out the mutation. You will need the codon table to answer this question. Wild type genomic sequence of a portion of a gene and the wild type sequence of portion of the protein gene product. The protein sequence only matches partially. TAT AAA GGG CGA CCA CCT GGT AAT GGG ACT TTG AGG Tyr Lys Gly Arg Pro Pro Ala Pro Arg Gin Tyr Trp Note: The five amino acids at the amino end of...

  • Answer the following question worth 12 points. You may consult any text (genetics text, internet, etc.)...

    Answer the following question worth 12 points. You may consult any text (genetics text, internet, etc.) or fellow classmate to help you answer the questions, but you must write your own response in your own words. Please do not consult faculty members. Please submit a word processed or PDF document to the designated assignment drop box on iCollege. 1. The wildtype sequence of part of a protein is: NH:-Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met... Each mutant in the following table differs from wildtype by a...

  • I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES...

    I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES FROM THE MRNA SEQUENCE. AM I GOING IN THE RIGHT DIRECTION WITH THE DNA SEQUENCES FOR THIS PROBLEM ? 1.The wildtype sequence of part of a protein is: NH2-Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met…             Each mutant in the following table differs from wildtype by a single point mutation (base substitution). Using this information, determine the DNA sequence coding for the wildtype polypeptide. If there is more than one...

  • 18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to...

    18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to the follo DNA :3TAC GCT GAG AGA GAC ACTS sº ATG CGA CTC TCT CTG TGA 3» 18b. (2pts) Does this mutation change the amino acid sequence? If yes - what is 18c. (2pts) Can this mutation change the way the protein functions? 18d. (2pts) How can a DNA mutation change protein function? Explain your answer in terms of gene expression. 15. Answer the...

  • To study DNA replication, researchers often use bacteria that harbor a temperature sensitive mutation in one...

    To study DNA replication, researchers often use bacteria that harbor a temperature sensitive mutation in one of the genes related to replication. This means that when cells are grown at lower temperatures (30°C) they are fine, but when shifted to 42°C the effect of the mutation becomes evident and that protein is no longer functional. Depending on the gene mutated, researchers observe that for some replication stops almost immediately, but for others more slowly. In this question you have a...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT