Question

1. The haplold human genome is 3 Gbp long (3x109 bp). How long would the genomic DNA In a single diploid cell In your body be If It were stretched out end to end? About 2 m 2. The haplold human genome is 3 Gbp long (3x109 bp). There are approximately 50 trillion cells in the human body. How long would all of the human genomic DNA in your body be if lt were stretch out end to end? 100 bllllon Km 3. Which shows correct hydrogen bond potential for adenine? Pic d 4. Which of the DNA structures is correct? Fig b 3 3 5 ?55 3 3 5 5
These 4 questions are answered, could someone please explain them to me? Thanks.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1) the diploid will be double the amount of DNA as of haploid. Hence it will be double in length as well. Therefore it's length shall be 2 x 3 = 6Gbp ( 6x109 bp).

Add a comment
Know the answer?
Add Answer to:
These 4 questions are answered, could someone please explain them to me? Thanks. 1. The haplold...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Biology Questions help me 1. Germline gene therapy would correct a genetic defect in: Select one:...

    Biology Questions help me 1. Germline gene therapy would correct a genetic defect in: Select one: a. an unaffected individual only. b. an unaffected individual and his or her offspring. c. an affected individual and all of his or her descendants. d. the parents of an affected individual. 2. An antigen is: Select one: a. any molecule that can elicit an immune response. b. a protein only. c. a nucleic acid only. d. a protein or nucleic acid. 3. Performing...

  • Help me with the workings for these questions please!!!! Question 1 Not answered Marked out of...

    Help me with the workings for these questions please!!!! Question 1 Not answered Marked out of 1.00 The speeds and colours of 1200 passenger cars passing a speed camera are recorded. Colours are recorded as being red, white or other Thirty percent are white and forty five percent are colours other then red or white. There are 397 cars which are speeding and 180 which are red and not speeding. What is the probability that a red car is speeding?...

  • Question 1 DNA and RNA belong to which of of these categories of macromolecule? Pick all...

    Question 1 DNA and RNA belong to which of of these categories of macromolecule? Pick all that APPLY Options: A.Carbohydrate B.Lipid C.Protein D.Nucleic acid E.Water Question 2 A certain molecule of DNA contains exactly 22% adenine. How much cytosine would you expect to find in this molecule? options A. 11% B. 22% C. 28% D. 56% E. 88% Question 3 The two sides of a double helix run in opposite directions (they are antiparallel). What does this mean? Options A....

  • Can someone carefully explain and answer questions 1, 2, 3, 4 and 5 in detail, please!!!...

    Can someone carefully explain and answer questions 1, 2, 3, 4 and 5 in detail, please!!! Multiplication can be thought of as repeated addition. Three times four is 4 added to itself 3 times. 1) Create an assembly program that multiplies two 8 bit integers (2's complement) together in your PIC, using the repeated summation technique 2) Add a feature to your program that detects if the answer is too big to hold in 8 bit 2's complement notation 3)...

  • Please help with all questions. I provided all the information that I have. The sequence below...

    Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc   1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...

  • Can someone carefully explain and answer questions 1, 2, 3, 4 and 5 in detail, please!!! Multiplication can be thought...

    Can someone carefully explain and answer questions 1, 2, 3, 4 and 5 in detail, please!!! Multiplication can be thought of as repeated addition. Three times four is 4 added to itself 3 times. 1) Create an assembly program that multiplies two 8 bit integers (2's complement) together in your PIC, using the repeated summation technique 2) Add a feature to your program that detects if the answer is too big to hold in 8 bit 2's complement notation 3)...

  • Please correct all questions because i did them wrong MATCHINGEnter the letter that best describes the...

    Please correct all questions because i did them wrong MATCHINGEnter the letter that best describes the reagent in the lefthand box below (12 Points) Answer G2 Buffer Proteinase K C1 Buffer Trypsin PBS VA. disrupts outer cell membrane of 3T3 fibroblasts B. phosphate buffered saline C. used to equilibrate Oiagen Genomic tip column D. precipitates DNA Eendonuclease, double stranded cleavage F. used to wash Qiagen Genomic tip column G. enzyme used to release 313 cells from culture task H. disrupts...

  • can someone help me answer these ? ive answered them but im not sure my answers...

    can someone help me answer these ? ive answered them but im not sure my answers are correct... 1. Would you expect attenuation control to occur in eukaryotes? Justify your answer. 2. Alpha-amanitin was found to have different effects on the three eukaryotic RNA polymerases.. Two types of eukaryotic RNA polymerases labelled as X and Y are given to you and your task is to identify these 2 RNA polymerases a. For this purpose you used very low concentrations of...

  • could someone help me understand these problems, the proper steps to solve them please. 1) A...

    could someone help me understand these problems, the proper steps to solve them please. 1) A person walks first at a constant speed of 1.35 m/s along a straight line from point to point and then back along the line from B to at a constant speed of 0.75 m/s. It takes the person 100s to walk from point @to point . a) What is her average speed over the entire trip? (10 points) b) What is her average velocity...

  • Please help with 1-16!!! (two pictures are attached) Thanks! Transcription . Although both prokaryotes and eukaryotes...

    Please help with 1-16!!! (two pictures are attached) Thanks! Transcription . Although both prokaryotes and eukaryotes put a cap and a tail on the mRNA, only eukaryotes have introns that have to be spliced out. (T/F) 2. The poly A tail on cukaryotic mRNA protects the RNA from rapid degradation in the cytoplasm. (T/F) 3. The polyA tail is added to eukaryotic mRNA immediatel after transport of the message from the nucleus. (T/F) 4. is usually a single stranded molecule....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT