Question

If you substituted the carbonyl in the peptide bond with a C-F bond, what would happen to the arrangement of an antiparallel

0 0
Add a comment Improve this question Transcribed image text
Answer #1

If we substitute the carbonyl in the peptide bond with the C-F bond, then F atom forms strong intermolecular H bonds with H atom of another strand due to which the strand comes closer to each other.

Option 1st is right answer.

Here is the solution of your question. If you have any doubt or need any clarification please comment in comment box and will definitely resolve your query. If you find useful please upvote it. Thanks in advance.

Add a comment
Know the answer?
Add Answer to:
If you substituted the carbonyl in the peptide bond with a C-F bond, what would happen...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 25. Consider two peptide sequences: LKAENDEAARAMSEA and CRAGGFPWDQPGTSN. Which of the two is more likely to adopt an al...

    25. Consider two peptide sequences: LKAENDEAARAMSEA and CRAGGFPWDQPGTSN. Which of the two is more likely to adopt an alpha-helical structure? Why? 26. A beta strand is a stretch of residues in the extended conformation that can participate in a beta sheet. (In the figure at right, beta strands A and B participate in a two-strand sheet.) What sorts of hydrogen bonds are required for the formation of single beta strands and for the formation of beta sheets? backbone- backbone sidechain...

  • 25. Consider two peptide sequences: LKAENDEAARAMSEA and CRAGGFPWDQPGTSN. Which of the two is more likely to adopt an al...

    25. Consider two peptide sequences: LKAENDEAARAMSEA and CRAGGFPWDQPGTSN. Which of the two is more likely to adopt an alpha-helical structure? Why? 26. A beta strand is a stretch of residues in the extended conformation that can participate in a beta sheet. (In the figure at right, beta strands A and B participate in a two-strand sheet.) What sorts of hydrogen bonds are required for the formation of single beta strands and for the formation of beta sheets? backbone- backbone sidechain...

  • Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th...

    Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th nucleotide were deleted? 5' GCU-UGU-UUA-CGA-AUU 3' Ala-Cys-Leu-Arg-Ile The entire peptide sequence would change The first amino acid would remain the same, but the others would change. None of the amino acids would change. The first two amino acids would remain the same, but the others would change. > Moving to another question will save this response.

  • 3. What statement about the peptide bond is TRUE?             a. Hydrolysis of the peptide...

    3. What statement about the peptide bond is TRUE?             a. Hydrolysis of the peptide bond is both thermodynamically and kinetically favorable.        b. Kinetic stability of the peptide bond is overcome by the increased nucleophilicity of the catalytic residue of the protease.            c. Formation of the acyl-enzyme intermediate distorts the resonance of the peptide bond.        d.The catalytic strategy of proteases needs to overcome the thermodynamic stability of the peptide bond by making the...

  • please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide...

    please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...

  • Hello, can you please help me out with these problems. Thanks in advance. When a zinc-containing enzyme hydrolyzes a peptide bond, what does the zinc 45. do to promote the hydrolysis? Zn O H20 Lys Va...

    Hello, can you please help me out with these problems. Thanks in advance. When a zinc-containing enzyme hydrolyzes a peptide bond, what does the zinc 45. do to promote the hydrolysis? Zn O H20 Lys Val Asp) Leu Pro It increases the electrophilicity of the carbonyl carbon. (A) (B) (C) (D) It increases the nucleophilicity of the carbonyl carbon It decreases the electrophilicity of the carbonyl carbon. It decreases the nucleophilicity of the carbonyl carbon. 46. Which acid catalyzed reagent...

  • Predict what would happen to the secondary structure of a protein if an alcohol that disrupts...

    Predict what would happen to the secondary structure of a protein if an alcohol that disrupts hydrogen bonding were added. Choose one or more answer (if applied): A. Nothing would happen to the protein; hydrogen bonding is not important for secondary structure B. The beta sheets would unfold, disrupting protein structure C. The a helixes would unfold, disrupting protein structure D. Individual amino acids would be hydrolyzed from the protein, disrupting protein structure

  • If there was no axial precession of the Earth, what would happen? this is not axial...

    If there was no axial precession of the Earth, what would happen? this is not axial tilt, this is axial precession 1.Seasonal change would get delayed slightly 2.Seasons would become milder or harsher depending on where you are 3.The seasons would get harsher

  • You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...

    You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...

  • Part C Assume that you have a cylinder with a movable piston. What would happen to...

    Part C Assume that you have a cylinder with a movable piston. What would happen to the gas volume of the cylinder if you were to decrease the pressure by 75% at constant T? The volume would decrease by 4 The volume would increase by 1 /4 The volume would decrease by 1/4 The volume would increase by 4 This is no volume change. Submit X Incorrect; Try Again; 5 attempts remaining Part D Assume that you have a cylinder...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT