Question

You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you cant find it in one of your biology books). 14) What peptide sequence would be produced if you inserted an extra T nucleotide in the DNA (between A&C, as shown in the figure above) (use the 3-letter abbreviation for amino acids)? 15) What would happen if you deleted the DNA region that encodes the Shine-Dalgarno motif? (What would it affect, transcription or translation ? How ?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Let us begin with finding answers for Descriptive questions as in Question no. 15. Then we move on to first 2 questions.

15. The Shine–Dalgarno sequence, (named after John Shine and Lynn Dalgarno, who first described the
sequence) is a ribosomal binding site in mRNA, usually located Upstream, that means towards 5' side from the initiator codon AUG. It is necessary for the isolation of the initiator codon in the three dimentional coiled structure of mRNA. This isolation was accomplished by using ribonuclease to digest mRNA–ribosome complexes (formed under conditions in which protein synthesis could begin but elongation could not take place). The purine-rich, Shine–Dalgarno sequence pairs with the 16s rRNA. The 3' end of this rRNA component contains a sequence of several bases that is complementary to the purine-rich region in the initiator sites of mRNA.

Thus this motif helps in initiation of protein synthesis by 2 means -

(1) the pairing of mRNA bases with the 3' end of 16S rRNA and

(2) the Isolation & pairing of the initiator codon on mRNA with the anticodon of an initiator tRNA molecule.

So obviously, if we delete this motif in DNA, mRNA will not have this sequence, no attachment of ribosomal RNA with mRNA and improper pairing of initiator codon ---> No Translation of Protein from that mRNA. But Transcription in this case will be uneventful as this sequence is nothing to do with mRNA synthesis from DNA.

13. Now, the Shine dalgarno sequence has been mentioned, and we can see the First Codon in mRNA as AUG for Amino acid Methionine. And we can proceed with 3 letter codon after AUG.

Here UAA is the STOP codon which Terminates the Amino acid elongation. So last GCC-3' will not be translated to Amino acid.

14. Coming to this part, An Extra T nucleotide in DNA will Transcribed as A in mRNA. Then the synthesized peptide would be different from the previous one, as the FRAME Shifts for One Base.

Shine-Dalgarno motif Site of insertion for question 14 AGAGGUAGUUAAGCC -3 hine-Dalgarno moti Met Ser- Gly - Asn - Cys - Glu -And it will terminated in UAG as STOP codon. Again UAAGCC- 3' will not be translated in Amino acid.

Thanks for asking.




Add a comment
Know the answer?
Add Answer to:
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th...

    Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th nucleotide were deleted? 5' GCU-UGU-UUA-CGA-AUU 3' Ala-Cys-Leu-Arg-Ile The entire peptide sequence would change The first amino acid would remain the same, but the others would change. None of the amino acids would change. The first two amino acids would remain the same, but the others would change. > Moving to another question will save this response.

  • A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is...

    A peptide from a novel bacterial protein was isolated and sequenced. The amino acid sequence is NH2-Leu-Met-Pro-Tyr-Ser-Ala-Ala-Pro-Cys-Leu-Trp-Glu-Ala-Gly-Asp-Arg-COOH. To verify and clone the gene encoding this protein from this uncharacterized bacterium, a student has to purify the bacterial genomic DNA and use it as the template to isolate the DNA fragment that encodes this peptide using PCR. The student plans to design a pair of oligonucleotides as the forward and reverse primers to PCR the DNA fragment that encodes this peptide....

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

    Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...

  • C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab...

    C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

  • If you know the DNA sequence a gene, it is possible to determine the mRNA sequence...

    If you know the DNA sequence a gene, it is possible to determine the mRNA sequence and the amino acid (Protein) sequence. If you only know the protein sequence, would you be able to accurately determine the mRNA sequence and DNA sequence? Explain.

  • 1) Using the bacterial DNA sequence that the instructor gave you:

    1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...

  • Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status:...

    Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...

  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT