Question

Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease

CTT TTA TAG TAG ATA CCA CAA AGG

a. What is the mRNA strand that is transcribed from the DNA shown above?

b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1?

c. If an individual has a G at position 15 (instead of A) the person will NOT have the disease. However, individuals with a C at position 14 (instead of T) do have the disease. Why would this be the case? Explain. Be sure to show that you understand how mutations affect protein structure.

d. What do you think will happen if you inserted or deleted a nucleotide from the original sequence given above? Explain.

e. Where do mutations in the original DNA come from? (i.e. what causes DNA

mutations?)

f. Are all mutations bad? Give and briefly explain an example of a mutation that provides an organism (bacteria or virus for example) with a survival advantage.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

DNA sequence - CTT TTA TAG TAG ATA CCA CAA AGG

a) mRNA sequence - GAA AAU AUC AUC UAU GGU GUU UCC

b) Protein sequence - Glu-Asn-Ile-Ile-Tyr-Gly-Val-Ser

c) Changing the codon from ATA to ATG will cause a shift in the mRNA codon, making UAU to UAC. Both of these codons code for the polar amino acid Tyrosine, and hence this mutation does not lead to an amino-acid level change. This phenomenon persists for most of the other amino acids, where changing the 3rd base of a codon doesn’t affect the translated product. This is explained by the wobble hypothesis which was formulated by Francis Crick to explain codon degeneracy, where more than one codon codes for the same amino acid.

This holds true only for the third base. Changing the base at position 14 from T to C (the second base of the codon) makes the codon ACA, making the mRNA codon UGU, which codes for the amino acid cysteine. Hence a mutation at the 14th position of this sequence leads to an amino acid change when translated, which can, in turn, perturb protein function by affecting its structure or activity.

d) An insertion or deletion of a base leads to frameshift mutations as the codons will now be out of frame from the original sequence, leading to a completely different or truncated product.

e) DNA mutations are caused by a wide range of factors, including copying errors, error-prone damage repair, and exposure to genotoxic agents, such as ionizing radiation and chemotherapy.

f) Mutations are neither good nor bad by nature. It is the environment which selects for or against a mutation. For example, if a mutation in a protein helps a bacteria to resist the activity of an antibiotic (antibiotic resistance), then those individuals that carry this mutation can outcompete the individuals that don’t carry it when under antibiotic selection. This mutated protein may not function as well as the normal protein, and hence the benefits may become apparent only when the bacteria are placed under antibiotic stress.

I hope this helps :)

Add a comment
Know the answer?
Add Answer to:
Shown below is the anti-sense DNA sequence from a region of a gene that produces a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

    mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...

  • PART C.  Use your codon chart to determine the amino acid sequence.  Remember to read through the strand...

    PART C.  Use your codon chart to determine the amino acid sequence.  Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop.  Follow example below: Example:                  DNA à  AGA CGG TAC CTC CGG TGG GTG CTT  GTC  TGT  ATC CTT  CTC  AGT  ATC               mRNA à  UCU GCC AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG               protein à                   start - glu – ala –thre – hist – asp –glu – threo - stop                                                                                                                                               acid                              acid 5.   DNA à  CTA TTA CGA TAC...

  • Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are...

    Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are these? How do you do the bottom?   Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

    Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • please help with #4 and #5 question 5 of 5 the cross lines indicate deletion of...

    please help with #4 and #5 question 5 of 5 the cross lines indicate deletion of the nucleotides. what type of mutation is this? what is the resulting polypeptide sequence? 3'- GTT - TAC - CTT - -CTC--TCC -TCA -GAC - ATC -GCA -5' (template strand) 5' - CAA - ATG - GAA - -GAG--AGG - AGT - CTG- TAG - CGT - 3' (non-template/coding strand) answer: It's a ___________________mutation. Final polypeptide sequence is N' - Met - GLU _______________    ...

  • B. Below is the part of the DNA sequence of the lacZ gene from the(+180 to...

    B. Below is the part of the DNA sequence of the lacZ gene from the(+180 to +210 base pair position. Design a DNA probe that would bind complimentary to the lacZ mRNA from the +195 to +210 base pair position (4pts) CCA +180 +195 +210 5' CTTTGCCTGGTTTCCGGCACCAGAAGCGGT 3' probe: FCGG5

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT