Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease
CTT TTA TAG TAG ATA CCA CAA AGG
a. What is the mRNA strand that is transcribed from the DNA shown above?
b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1?
c. If an individual has a G at position 15 (instead of A) the person will NOT have the disease. However, individuals with a C at position 14 (instead of T) do have the disease. Why would this be the case? Explain. Be sure to show that you understand how mutations affect protein structure.
d. What do you think will happen if you inserted or deleted a nucleotide from the original sequence given above? Explain.
e. Where do mutations in the original DNA come from? (i.e. what causes DNA
mutations?)
f. Are all mutations bad? Give and briefly explain an example of a mutation that provides an organism (bacteria or virus for example) with a survival advantage.
DNA sequence - CTT TTA TAG TAG ATA CCA CAA AGG
a) mRNA sequence - GAA AAU AUC AUC UAU GGU GUU UCC
b) Protein sequence - Glu-Asn-Ile-Ile-Tyr-Gly-Val-Ser
c) Changing the codon from ATA to ATG will cause a shift in the mRNA codon, making UAU to UAC. Both of these codons code for the polar amino acid Tyrosine, and hence this mutation does not lead to an amino-acid level change. This phenomenon persists for most of the other amino acids, where changing the 3rd base of a codon doesn’t affect the translated product. This is explained by the wobble hypothesis which was formulated by Francis Crick to explain codon degeneracy, where more than one codon codes for the same amino acid.
This holds true only for the third base. Changing the base at position 14 from T to C (the second base of the codon) makes the codon ACA, making the mRNA codon UGU, which codes for the amino acid cysteine. Hence a mutation at the 14th position of this sequence leads to an amino acid change when translated, which can, in turn, perturb protein function by affecting its structure or activity.
d) An insertion or deletion of a base leads to frameshift mutations as the codons will now be out of frame from the original sequence, leading to a completely different or truncated product.
e) DNA mutations are caused by a wide range of factors, including copying errors, error-prone damage repair, and exposure to genotoxic agents, such as ionizing radiation and chemotherapy.
f) Mutations are neither good nor bad by nature. It is the environment which selects for or against a mutation. For example, if a mutation in a protein helps a bacteria to resist the activity of an antibiotic (antibiotic resistance), then those individuals that carry this mutation can outcompete the individuals that don’t carry it when under antibiotic selection. This mutated protein may not function as well as the normal protein, and hence the benefits may become apparent only when the bacteria are placed under antibiotic stress.
I hope this helps :)
Shown below is the anti-sense DNA sequence from a region of a gene that produces a...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop. Follow example below: Example: DNA à AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC mRNA à UCU GCC AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG protein à start - glu – ala –thre – hist – asp –glu – threo - stop acid acid 5. DNA à CTA TTA CGA TAC...
Did I answer the mRNA sequences
and Amino acid sequences correctly? What types of mutations are
these? How do you do the bottom?
Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
please help with #4 and #5
question 5 of 5
the cross lines indicate deletion of the nucleotides.
what type of mutation is this? what is the resulting polypeptide
sequence?
3'- GTT - TAC - CTT - -CTC--TCC -TCA -GAC - ATC -GCA
-5' (template strand)
5' - CAA - ATG - GAA - -GAG--AGG - AGT - CTG- TAG -
CGT - 3' (non-template/coding strand)
answer: It's a ___________________mutation.
Final polypeptide sequence is N' - Met - GLU
_______________ ...
B. Below is the part of the DNA sequence of the lacZ gene from the(+180 to +210 base pair position. Design a DNA probe that would bind complimentary to the lacZ mRNA from the +195 to +210 base pair position (4pts) CCA +180 +195 +210 5' CTTTGCCTGGTTTCCGGCACCAGAAGCGGT 3' probe: FCGG5