RNA polymerase enzyme will transcribe in 5'>3' direction. so the mRNA in this case will be produced from the complementary strand of the given DNA sequence. The lacZ mRNA from +195 to +210 will be,
5'- CGGCACCAGAAGCGGU -3'
A DNA probe is a fragment of DNA of variable length which will be radioactively or fluorescently labelled and complementary to its target nucleotide sequence. So the DNA probe complementary for this mRNA would be ,
3'- GCCGTGGTCTTCGCCA -5'
B. Below is the part of the DNA sequence of the lacZ gene from the(+180 to...
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
The transcribed portion of a DNA sequence for a gene is shown below. Identify the mRNA sequence and the polypeptide sequence that would be produced from this gene. Also, identify the specific type of DNA mutation and protein mutation that would result if the underlined A/T basepair was mutated to a C/G basepair. NOTE: Assume RNA polymerase is moving left to right across the page. 3' - TATACGCGATATGGATTC - 5 5'- ATATGCGCTATACCTAAG - 3
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA using nucleic acid hybridization. 5' - AAUCGAUGGUCGAAAUGCTCGAUCAGCUAGCUAGC - 3'
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid:
Can someone outline how I would go from my DNA sequence to my
final product of coding the amino acids. I am confused on the
complimenting strands and which ones I would need.
Below is the coding sequence of very small prokaryotic gene. The coding sequence is shown in red while the regulatory sequences are shown in black and the UTR in blue. The underlined sequences denote the -10 sequence. The arrow marks the point of a 5 base insertion...
The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold and italicized, and the promoter is enclosed in parenthesis. 5′ T G*A A G G A A T (TA T A A) T A C G A C C... A T G A T G T A C G C A T AAAC G T 3′ A mutation occurs in which a base (T) is inserted into the DNA sequence after the G, at...