In the fourth mutation you simulated a point mutation by changing the 10th nucleotide from T...
In the fourth mutation you simulated a point mutation by changing the 10th nucleotide from T to A. What type of mutation was this?
Homework Answers
Changing the 10th nucleotide from T to A is base substitution mutation which is a form of point mutation. A substitution mutation is the mutation that exchanges one base with another such as replacement of T by A or C by G etc. Such a substitution could change a codon to one that encodes a different amino acid and cause a small change in the protein produced.
Add Answer to:
In the fourth mutation you simulated a point mutation by
changing the 10th nucleotide from T...
What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide...
What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide insertion O single nucleotide substitution (point mutation) O trinucleotide repeat
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
can i ge thelp changing this to point mutation , insertion , deletion 1) DNA can...
can i ge thelp changing this to point mutation , insertion ,
deletion
1) DNA can be mutated in one of the three ways. A sample strand of DNA has been provided for you. Select whichever sites are appropriate and show how each type of mutation type would change the DNA by redrawing the newly mutated strand. Also, describe how each mutation changes the protein that is made from the resulting DNA. They are numbered for easy reference. A G...
What is the difference between a silent mutation, point mutation and a missense mutation? If you...
What is the difference between a silent mutation, point mutation and a missense mutation? If you not mind, can you type the answer. Please Thanks
What is the difference between a silent mutation, point mutation and a missense mutation? If you...
What is the difference between a silent mutation, point mutation and a missense mutation? If you not mind, can you type the answer.I do not understand handwriting in sometime. Please Thanks
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
5'-ATG-TCC-TCG-AAT-TTT-CCC-3' if a student induces a 2-nucleotide deletion to this sequence resulting in a frameshift mutation,...
5'-ATG-TCC-TCG-AAT-TTT-CCC-3' if a student induces a 2-nucleotide deletion to this sequence resulting in a frameshift mutation, changing the 3rd through 5th amino acids to Glu Phe Ser, what two nucleotides were deleted?
Question 31 3 pts You are investigating the impact of a point mutation on the structure...
Question 31 3 pts You are investigating the impact of a point mutation on the structure of the encoded protein and find that the encoded protein is substantially shorter than normal, and the amino acid sequence near the end of the protein is different from the amino acid sequence at the same location in the normal protein. What type of point mutation could cause this? Insertion or deletion Mutation in the promotor Altered sequence at a splice site Change in...
Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in...
Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in the alteration of ______________, and the resulting protein has ______________. a) only one codon / at least three amino acid changes b) three codons / a single amino acid change c) only one codon / a single amino acid change d) three codons / three amino acid changes
11. Deoxyribose 12. 13. 14. 15. 16. Nucleus Point mutation Deletion mutation Exons Translation Nitrogenous bases...
11. Deoxyribose 12. 13. 14. 15. 16. Nucleus Point mutation Deletion mutation Exons Translation Nitrogenous bases H bonded mRNA A. Molecule that carries instructions for making a protein from a gene in the nucleus to a ribosome in the cytoplasm B. Enzyme that unwinds DNA double helix C. Sugar found in DNA nucleotide D. Process of making a protein E. Substitution of one nucleotide base pair for another F. Rungs (steps) of DNA "ladder" G. Transcription occurs in this part...
What type of DNA mutation is this? Original strand: A-T-C-G-T-A-G-G-C-T-A-G Mutated strand: A-T-C-G-A-T-A-G-G-C-T-A-G nucleotide deletion nucleotide insertion O single nucleotide substitution (point mutation) O trinucleotide repeat
can i ge thelp changing this to point mutation , insertion ,
deletion
1) DNA can be mutated in one of the three ways. A sample strand of DNA has been provided for you. Select whichever sites are appropriate and show how each type of mutation type would change the DNA by redrawing the newly mutated strand. Also, describe how each mutation changes the protein that is made from the resulting DNA. They are numbered for easy reference. A G...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Question 31 3 pts You are investigating the impact of a point mutation on the structure of the encoded protein and find that the encoded protein is substantially shorter than normal, and the amino acid sequence near the end of the protein is different from the amino acid sequence at the same location in the normal protein. What type of point mutation could cause this? Insertion or deletion Mutation in the promotor Altered sequence at a splice site Change in...
11. Deoxyribose 12. 13. 14. 15. 16. Nucleus Point mutation Deletion mutation Exons Translation Nitrogenous bases H bonded mRNA A. Molecule that carries instructions for making a protein from a gene in the nucleus to a ribosome in the cytoplasm B. Enzyme that unwinds DNA double helix C. Sugar found in DNA nucleotide D. Process of making a protein E. Substitution of one nucleotide base pair for another F. Rungs (steps) of DNA "ladder" G. Transcription occurs in this part...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago