Question

19. You clone your favorite E. coli gene including the promoter region, the open reading frame, and some flanking DNA. You de
can you guys please give me the correct answers and explain why?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

19. A rut site - it is the sequence get recognised by rho protein and translation termination takes place . A polyadenylation signal has a different sequence .

20. D. The capping machinery assembles on the Phosphorylated pol II tail . Pol II has a C-terminal domain (CTD) that gets Phosphorylated during transcription and these Phosphorylated sites recruit capping machinery .

21. P site . Ribosomes has 3 sites E , P and A site at A site aminoacyl-tRNA binds then get transferred to P site where peptide bond formation takes place by between the partially synthesized protein and amino acid on tRNA then it moves to exit site (E site ) .

Add a comment
Know the answer?
Add Answer to:
can you guys please give me the correct answers and explain why? 19. You clone your...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • can you guys please give me the correct answers and explain why? 3. Which of the...

    can you guys please give me the correct answers and explain why? 3. Which of the following statements is CORRECT? A. Exposure of E.coli to UV light greatly increases the frequency of cytosine deamination B. Mutagens that intercalate into the double helix lead to the formation of thymine dimers. C) Oxidative damage to DNA usually leads to the formation of frameshift mutations. D. Some alkylating agents are mutagenic because they chemically modify amino acids in the active site of DNA...

  • can you guys please give me the correct answers and explain why? 9. Which of the...

    can you guys please give me the correct answers and explain why? 9. Which of the following statements is INCORRECT? A. Most human cells contain high levels of telomerase. B. Telomeres protect the ends of eukaryotic chromosomes. C. Telomerase is ribonucleoprotein D. Each round of replication shortens eukaryotic chromosomes. E. Telomerase is an RNA-dependent DNA polymerase. 10. DNA in front of the replication fork is positively supercoiled (over-wound). What is the source of energy required for this over-winding? Pollll Core...

  • can you guys please give me the correct answers and explain why? 30. Which of the...

    can you guys please give me the correct answers and explain why? 30. Which of the following statements reg wing statements regarding the Alpha subunit of RNA polymerase is INCORRECT? A. Can bind an UP element B. Can interact with positive activator proteins C. Binds to the Beta and Beta' subunits D. Has distinct N-terminal and C-terminal domains E. Has 3' to 5' exonuclease activity 31. Which of the following statements regarding the mediator complex is arding the mediator complex...

  • can you guys please give me the correct answers and explain why? 27. Which of the...

    can you guys please give me the correct answers and explain why? 27. Which of the following statements regarding tRNAs is INCORRECT? A. In the folded structure of a tRNA, the anticodon loop is located near the 3' end of the molecule. B. Highly conserved nucleotides de primarily in the "loops" rather than the "stems". C. All tRNAs have the same 3 base sequence at their 3 end. D. All tRNAs contain post-transcriptionally modified nucleotides. E. In most cells, tRNA...

  • can you guys please give me the correct answers and explain why? 25. The non-template strand...

    can you guys please give me the correct answers and explain why? 25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA...

  • can you guys please give me the correct answers and explain why? 12. Which of the...

    can you guys please give me the correct answers and explain why? 12. Which of the following statements concerning histones is INCORRECT? A. The N-terminal tails of histone proteins are frequently post-translationally modified B. Histones are small, basic proteins. C. Histones bind DNA via hydrogen bonding with bases in the major groove. D. Histone HI is not one of the core histones. E. Histones are present in eukaryotes but not bacteria. V 13. You are studying two E coli genes...

  • Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...

    Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...

  • You are using a ChIP assay to study the positioning of a DNA-binding transcription factor (Dbp1p)...

    You are using a ChIP assay to study the positioning of a DNA-binding transcription factor (Dbp1p) on transcribed genes. You fragment DNA from wild type cells and immunoprecipitate Dbp1p with an antibody to it. Then you PCR amplify the DNA associated with Dbp1p using different sets of primers for a particular gene (G3PD). One set of primers was specific for the TATA box region of this gene, (lane 1) another pair of primers amplified the 3’ end of the open...

  • can someone explain how to answer this with reasons why 30-45 mins after estrogen addition: Acchyiase...

    can someone explain how to answer this with reasons why 30-45 mins after estrogen addition: Acchyiase (HAT, odde auhye 60-90 mins after estrogen addition: Reauitment ef Poy to open 7. T identify the Gene X DNA element responsible for regulation by a Growth Fagor, you perform a linker scanning experiment in which you mutate 10 bp Tegions centered around positions -205 to-5 in the Gene X promoter/promoter- proximal region (wt wild-type promoter). The promoter variants were tested for their ability...

  • 13. Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates? A....

    13. Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates? A. Only ribonucleoside triphosphates contain the sugar ribose. B. Ribonucleoside triphosphates have low potential energy, making the polymerization reaction endergonic. C. Ribonucleoside triphosphates have high potential energy, making the polymerization reaction exergonic. D. Ribonucleoside monophosphates cannot form complementary base pairs with the DNA template. E. Ribonucleoside triphosphates are not used, rather all use deoxyriboside triphosphates. 14. How is a mutation in a bacterial cell that...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT