Question

a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in...

a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in length? b) In agarose gel electrophoresis, two parallel and oppositely charged electrodes are situated at opposite ends of the gel. The surrounding solution is a “buffer”, an aqueous salt solution maintained at constant pH. The gel is made in the same buffer, with a small concentration of agarose. Because the concentration of agarose is small , everything between the electrodes can be considered to have the same dielectric constant. In the schematic below, sketch the electric field lines within the apparatus, taking care to note their direction. c) In what direction would the DNA feel a force and move spontaneously because of this electric field? d) Generally, the user “runs a gel” by applying a constant (DC) voltage between the two electrodes. A common operating voltage is 90V. Under this potential difference, the current flowing between the two electrodes is measured to be 60 mA. What is the resistance of the gel + buffer solution between the electrodes? Show your work. e) If the distance between the electrodes were doubled and the voltage were held constant, what would you expect to happen to the current? Justify your answer. f) What is the electric power needed to run the experiment in part (d)? g) If the “gel runs” (voltage is applied) for 1 hour, how much energy is used?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Hi,

Hope you are doing well.

(a)

Net charge of a double-stranded DNA is Negative charge. Phosphate groups in the backbone of DNA have negatively charged oxygen molecules which gives the backbone of DNA an overall negative charge and thus DNA a total negative charge.

(b)

We know that electric field direction will be from positive electrode (Anode) to negative electrode (Cathode) as shown below.

Cathode Direction of electric field +) Anode

(c)

Since DNA is negatively charged, it will have a tendency to move towards the Anode (positive electrode). So the DNA Fragments move towards Anode through agarose gel/gel medium.

(d)

According to Ohm's Law, We know that, Resistance,

R=rac{V}{I}Omega

Where,

'R' is the Resistance of gel. (ohms)

'V' is the Potential difference between electrodes. (Volts)

'I' is the Current flowing through gel/medium.(Ampere)

Given that,

Potential difference between electrodes, V=90mathbf{V}

Current flowing through gel/medium, 60mA= 60 x 10-3A

herefore R=rac{V}{I}=rac{90mathbf{V}}{60 imes 10^{-3}mathbf{A}}=1.5 imes10^{3} mathbf{Omega }=1500 mathbf{Omega}

mathbf{ie;} R=1500 mathbf{Omega}

(e)

We know that,

pl

Where,

'R' is the Resistance of gel. (ohms)

'ho' is the Resistivity of gel. (ohm-meter) [Constant]

'A' is the Area of gel. (ohms)

From the above equation, It is clear that, When distance is doubled, Resistance of medium will be doubled.

hereforeNew resistance, R_{1}

R_{1}=2R=2 imes 1500Omega =3000Omega

According to Ohm's Law, We know that, Current,

I=rac{V}{R}mathbf{A}

Where,

'I' is the Current flowing through gel/medium.(Ampere)

'R' is the Resistance of gel. (ohms)

'V' is the Potential difference between electrodes. (Volts)

Given that,

Potential difference between electrodes, V=90mathbf{V}

New Resistance of gel, R_{1}=3000Omega

90V 30 × 10-3A = 30mA R1 300012

mathbf{ie;} I_{1}=30 mathbf{mA}

ie; Current flowing between electrode is halved, when the distance between electrodes is doubled.

(f)

We know that,

Power consumed, P

P=VI

Where,

'P' is the Power consumed.(Watts)

'I' is the Current flowing through gel/medium.(Ampere)

'V' is the Potential difference between electrodes. (Volts)

Given that,

Potential difference between electrodes, V=90mathbf{V}

Current flowing through gel/medium, 60mA= 60 x 10-3A

herefore P=VI=90mathbf{V} imes60 imes10^{-3}mathbf{A}=5.4mathbf{W}

mathbf{ie;}P=5.4mathbf{W}

(g)

We know that,

Energy used, E

E=VIt

Where,

'E' is the Energy used. (Joules)

'I' is the Current flowing through gel/medium.(Ampere)

'V' is the Potential difference between electrodes. (Volts)

't' is the time consumed .(seconds)

Given that,

Potential difference between electrodes, V=90mathbf{V}

Current flowing through gel/medium, 60mA= 60 x 10-3A

Time consumed, t=1 mathbf{hour}=1 imes60 imes60mathbf{s}=3600mathbf{s}

herefore E=VIt=90mathbf{V} imes60 imes10^{-3}mathbf{A} imes3600mathbf{s}=19440mathbf{J}

mathbf{ie;}E=19440mathbf{J}

Hope this helped for your studies. Keep learning. Have a good day.

Feel free to clear any doubts at the comment section.


Please don't forget to give a thumps up.

Thank you. :)

Add a comment
Know the answer?
Add Answer to:
a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • 18 15 16 17 7- What is the concentration of DNA whereby a 1:100 dilution has...

    18 15 16 17 7- What is the concentration of DNA whereby a 1:100 dilution has an observance reading of 0.015 at 260 nm? a. 6 ug mL b. 60 ug/mL c. 75 ug/mL d. 750 ug/mL 8- When measuring the concentration of RNA by spectrophotometry at 260 nm, the absorbance reading is multiplied by the dilution and a conversion factor of a. 20 6.30 c. 40 d. 50 9-DNA is isolated from a clinical sample. The absorbance at 260...

  • What solution is used to isolate the DNA from the bacterial cells 7. Alkaline lysis buffer...

    What solution is used to isolate the DNA from the bacterial cells 7. Alkaline lysis buffer b Acidic lysis buffer RNase C d None of the above 8 What solution is used to isolate the DNA from the spin column? DNA buffer a. b. Elution buffer P1 c. d. P2 9 EcoRI restriction site is 5' GAATTC 3' and 3' CTTAAG 5 a 5' GAATTC 3' and 3' CTTAAG 5 b 5' GAATTC 3' and 3' CTTAAG 5 C. d....

  • En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard...

    En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....

  • Protein molecules in solution can be separated from each other by taking advantage of their net...

    Protein molecules in solution can be separated from each other by taking advantage of their net charges. In the electric field between two electrodes, a positively charged particle moves toward the negative electrode and a negatively charged particle moves toward the positive electrode. This movement, known as electrophoresis, varies with the strength of the electric field, the charge of the particle, the size and shape of the particle, and the buffer/polymer gel combination through which the protein is moving. The...

  • Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are...

    Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...

  • Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one...

    Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...

  • I need the answers for questions 2 and 3. My DNA ladder is in lane 2...

    I need the answers for questions 2 and 3. My DNA ladder is in lane 2 marked by the yellow arrow. Thanks! Here is the only other info I have. Thanks! Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...

  • Form 2: Page 6 A point charge Q is placed at the origin at r=0. What...

    Form 2: Page 6 A point charge Q is placed at the origin at r=0. What is the electric potential V at a distancer from this point charge? a. kQ/r2 b. kQ²/1 c.-k / d. -kQ/ kor An electric field in one dimension varies as E(x)=CX The potential is zero at x = 0 What is the potential V(x)? a-CX2/2 b. 2CX-32/3 c. -2CX32/3 d. -2CX 2 Cx12/3 18. The electric field vector between two charges of - and in...

  • v3. At what distance from a point charge of 4.0 nC does the electric field have...

    v3. At what distance from a point charge of 4.0 nC does the electric field have a magnitude of 4.0 N/C? (3.0 m) 4. Two small identical conducting spheres are placed with their centers 0.30 m apart. One is given a charge of 1 0 x10* c other a charge of -3.0 x10 C. (a) Find the electrostatic force exerted on one sphere by the other. (3.0 x 10"N, attraction) the (b) e spheres are connected by a conducting wire....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT